Role of YAP in early ectodermal specification and a Huntington's Disease model of human neurulation

  1. Francesco M Piccolo
  2. Nathaniel R Kastan
  3. Tomomi Haremaki
  4. Qingyun Tian
  5. Tiago L Laundos
  6. Riccardo De Santis
  7. Andrew J Beaudoin
  8. Thomas S Carroll
  9. Ji-Dung Luo
  10. Ksenia Gnedeva
  11. Fred Etoc
  12. AJ Hudspeth
  13. Ali H Brivanlou  Is a corresponding author
  1. Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, United States
  2. Howard Hughes Medical Institute, The Rockefeller University, United States
  3. Laboratory of Sensory Neuroscience, The Rockefeller University, United States
  4. ICBAS - Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto, Portugal
  5. i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Portugal
  6. INEB - Instituto de Engenharia Biomédica, Universidade do Porto, Portugal
  7. Bioinformatics Resource Center, The Rockefeller University, United States


The Hippo pathway, a highly conserved signaling cascade that functions as an integrator of molecular signals and biophysical states, ultimately impinges upon the transcription coactivator Yes-associated protein 1 (YAP). Hippo-YAP signaling has been shown to play key roles both at the early embryonic stages of implantation and gastrulation, and later during neurogenesis. To explore YAP’s potential role in neurulation, we used self-organizing neuruloids grown from human embryonic stem cells on micropatterned substrates. We identified YAP activation as a key lineage determinant, first between neuronal ectoderm and nonneuronal ectoderm, and later between epidermis and neural crest, indicating that YAP activity can enhance the effect of BMP4 stimulation and therefore affect ectodermal specification at this developmental stage. Because aberrant Hippo-YAP signaling has been implicated in the pathology of Huntington’s Disease (HD), we used isogenic mutant neuruloids to explore the relationship between signaling and the disease. We found that HD neuruloids demonstrate ectopic activation of gene targets of YAP and that pharmacological reduction of YAP’s transcriptional activity can partially rescue the HD phenotype.

Editor's evaluation

This manuscript harnesses an organoid model of human neurulation to unravel the role of the Hippo signalling pathway in the specification of the three key ectodermal cell types. The authors then investigate how these mechanisms are dysregulated in an organoid model of Huntington's Disease. This work will be of broad interest to readers interested in the process of neurulation and how dysregulation of developmental mechanisms may lead to disease conditions in adulthood.


Although the study of embryogenesis benefits from a broad array of model organisms and the conservation of mechanisms across species, elucidation of the particularities of human development remains challenging. The use of human pluripotent stem cells for the creation of synthetic human organoids has greatly enhanced our ability to investigate human development (Kim et al., 2020). For example, the process of neurulation can be mimicked in vitro through micropattern-based neuruloids (Haremaki et al., 2019). This technique, which allows the generation of hundreds of virtually identical organotypic cultures, offers a powerful opportunity to investigate the molecular and biophysical principles of human neurulation and the associated diseases.

The Hippo pathway is an ancient and highly conserved signaling cascade that operates in numerous cell types and a variety of organisms. In contrast to developmental pathways that require specific ligand-receptor interactions, the Hippo pathway functions as an integrator of molecular signals and biophysical states, including cell polarity, adhesion, GPCR signaling, and mechanical forces sensed through the cytoskeleton. With key roles in development, homeostasis, and regeneration, the pathway interacts with other developmental and regulatory signals including Wnt, Notch, and TGFβ. Despite the apparent complexity, the core cascade is relatively simple, including the parallel mammalian STE20-like kinases 1 and 2 (MST1/2) and mitogen-activated protein kinase kinase kinase kinase (MAP4K). The activity of these enzymes leads to phosphorylation of large tumor suppressor kinases 1 and 2 (LATS1/2), which in turn phosphorylate and limit the nuclear localization of Yes-associated protein 1 (YAP) and the homologous WW domain-containing transcription regulator 1 (TAZ). When they translocate to the nucleus, YAP and TAZ cooperate with TEA-domain transcription factors (TEAD1/2/3/4) to activate the expression of a variety of genes associated with proliferation, cell survival, de-differentiation, and cellular morphogenesis (Davis and Tapon, 2019; Hansen et al., 2015; Juan and Hong, 2016; Moya and Halder, 2019).

Hippo-YAP signaling is essential at various stages of embryonic development, including the zygote, early blastomeres, the inner cell mass (ICM), trophectoderm (TE), and the emergence of individual organs (Wu and Guan, 2021). Because Yap−/− mice die at E8.5 owing to the failure of endothelium formation in the yolk sac, and Yap−/−, Taz−/− embryos fail prior to the morula stage, investigating the potential role of Yap in neurulation in vivo requires complex transgenic strategies (Morin-Kensicki et al., 2006; Nishioka et al., 2009). The use of neuruloids derived from human embryonic stem cells (hESCs) therefore offers a convenient, highly reproducible, and quantitative alternative means of investigating the role of Hippo signaling in neurulation.

Here, we identify YAP activation as a key lineage determinant, first between neuronal ectoderm (NE) and nonneuronal ectoderm (NNE), and later between epidermis and neural crest (NC), in human embryo models. Exploiting the reproducible phenotype of Huntington’s Disease (HD) mutations in neuruloids, we additionally find that HD neuruloids demonstrate stronger YAP’s downstream transcriptional signature and that the pharmacological reduction of YAP’s transcriptional activity partially reverses the HD phenotype.


Differential YAP activity in neural and nonneural ectoderm

In order to study the role of the Hippo pathway during human neurulation in vitro, we applied a neuruloid assay (Haremaki et al., 2019). Pluripotent hESCs were grown on circular, 500-µm diameter circular substrates and converted to ectodermal fates by dual SMAD inhibition for 3 days (SB431542 and LDN193189, SB+LDN, and neural induction) followed by removal of LDN and BMP4 stimulation (SB+BMP4 and neurulation). As previously reported, stimulation until the fourth day after plating, which we designate hereafter as D4, led to the induction of NNE at the edge and NE in the center (Haremaki et al., 2019; Figure 1A).

Figure 1 with 11 supplements see all
Dynamics of YAP expression and localization in early neuruloids.

(A) During the first 4 days of the differentiation protocol, pluripotent hESCs seeded on a micropattern undergo 3 days of neural induction (SB +LDN) followed by BMP4 induction of neurulation (SB +BMP4). (B) Fluorescent images of living YAP-GFP and H2b-Cherry hESC colonies during neural induction show the progressive shift of YAP from nuclei into cytoplasm and a reduction in expression level. (C) Fluorescent images portray one quadrant of a colony acquired before (D3) and 24 hr after (D4) BMP4 administration. (D) Immunoblots from D0 to D4 of the neuruloid protocol illustrate the decrease in YAP phosphorylated at residue S127 (pYAP) upon treatment with 10 µM TRULI. The amount of total YAP protein (tYAP) initially declines but recovers by D4. Vinculin serves as a loading control. (E) Left: Immunolabeling of D4 neuruloids demonstrates the increased concentration of YAP and TFAP2A, a marker of NNE, at the edges of colonies treated for 24 hr with 10 µM TRULI. Right: Radial distribution of YAP and TFAP2A nuclear signals from several micropattern colonies quantitate the result. The average values at the edge of each colony are also shown. ****, p<0.0001; ***, p<0.001 in unpaired t-tests comparing untreated (control) and TRULI-treated samples. Nine colonies were analyzed for each condition. hESC, human embryonic stem cell.

To assess Hippo-YAP signaling during these early stages of neuruloid formation, we genetically engineered the RUES2 hESC line (National Institutes of Health #0013) to endogenously and biallelically tag the C-terminus of YAP protein with green fluorescent protein (GFP; Figure 1—figure supplement 1 and Figure 1—figure supplement 2; Franklin et al., 2020). During the pluripotency state at the outset of culture, at D0, YAP was highly expressed in the nuclei, and progressively enriched in the cytoplasm upon neural induction. YAP expression was downregulated by D3 (Figure 1B and C).

Live imaging 24 hr after BMP4 stimulation (D4), revealed upregulation of YAP expression at the edge of the colony, in the region where the NNE lineage would emerge. This upregulation at the periphery was BMP4-dependent. At this stage, the upregulation of YAP at the periphery depended on BMP4 stimulation, which might directly regulate YAP expression, for SMAD1, the transcription factor downstream of BMP4 signaling, appeared to be enriched in its promoter and regulatory regions (Figure 1—figure supplement 3A and B). Near the border of the colony, YAP could be observed to undergo sporadic nuclear enrichment (Figure 1C; Figure 1—video 1; Figure 1—video 2, Figure 1—video 3) suggesting dynamic regulation of the protein’s localization in the developing NNE lineage.

YAP activation with TRULI augments differentiation of nonneural ectoderm

Immunoblot analyses of D4 neuruloids confirmed a rise in YAP levels and revealed phosphorylation of YAP at residue S127, consistent with regulation through the Hippo pathway (Figure 1D). Concomitant application of the Lats-kinase inhibitor TRULI (Kastan et al., 2021) suppressed YAP phosphorylation without altering the dynamics of the protein’s concentration during this initial phase of neuruloid self-organization (Figure 1D). The immunoblots also showed that at the pluripotent stage (D0) YAP was expressed as two protein isoforms (Figure 1D; Figure 1—figure supplement 1), both downregulated during neural induction (D1–D3; Figure 1D; Figure 1—figure supplement 4A). The upregulation upon BMP4 induction primarily involved the larger, upper band.

Consistent with the loss of S127 phosphorylation, administration of TRULI in conjunction with BMP4 increased the level of YAP protein and induced its nuclear localization in cells at the edges of neuruloid colonies (Figure 1E; Figure 1—figure supplement 5; Figure 1—video 4, Figure 1—video 5 and Figure 1—video 6). Finally, TRULI-treated neuruloids demonstrated more robust TFAP2A expression, suggesting enhanced NNE induction (Figure 1E). These results together suggest that: YAP expression is upregulated in response to BMP4 at the periphery of the colony and is subsequently regulated in part by the Hippo pathway, contributing directly to induction of the NNE lineage.

YAP activity contributes to differentiation of neural crest and epidermis

After the initial separation of the NE and NNE lineages at D4, maturation to a complete neuruloid occurs by D7 (Haremaki et al., 2019). In the course of this process, the NE organizes into a compact, closed structure at the center of the colony. The NNE differentiates further, forming two principal derivatives: NC, which is found in a radially symmetric arrangement at the periphery of the neuruloid, and epidermal cells (E), which grow atop the culture (Figure 2A). The overall structure models the early stages of human neurulation (Haremaki et al., 2019). On D6, YAP levels rose sharply with a concomitant increase of phospho-S127 YAP (Figure 2B; Figure 1—figure supplement 4B). The effect predominantly involved the larger isoform, which continued to be upregulated following BMP4 induction. Fluorescence-activated cell sorting on D7 demonstrated that enrichment of YAP in NNE (PAX6−) relative to NE (PAX6+) persisted through maturation of the neuruloid (Figure 2C).

Figure 2 with 1 supplement see all
Dynamics of YAP expression and localization in late neuruloids.

(A) In a schematic side view of the final phase of neuruloid formation, neural ectoderm (NE, dark blue) at the center is surrounded by nonneural ectoderm (NNE, cyan), which subsequently differentiates into neural crest (NC, red) and epidermis (yellow). (B) Immunoblot analysis of neuruloids at D4–D7 demonstrates the suppression of YAP phosphorylated on residue S127 (pYAP) by 10 µM TRULI. The concentration of total YAP protein (tYAP) increases under both conditions. Vinculin provides a loading control. (C) Analysis by fluorescence-activated cell sorting of D7 neuruloids shows less expression of total YAP protein in NE (PAX6+) than in NNE (PAX6−). The difference in YAP expression level between the two lineages was analyzed by both two-way ANOVA and nonparametric t-tests, consistently showing p<0.000001. (D) Immunohistochemistry during the late phase of neuruloid formation, D4–D6, shows the progressive decline in nuclear YAP in NE and NC lineages. For four neuruloid colonies at each time point, the nuclear signals of YAP, PAX6, and SOX10 were determined in individual cells. Scatterplots and box plots of normalized YAP signals quantify the effect. ****, p<0.0001 in unpaired nonparametric t-tests comparing the level of normalized nuclear YAP signal between the different conditions. (E) Immunofluorescence images of one quadrant of a D5 neuruloid demonstrate the presence of KRT18, a label for epidermis, in cells enriched for nuclear YAP.

We assessed the expression and localization of YAP within the major ectodermal lineages at different times during neuruloid formation (Figure 2D and E; Figure 2—figure supplement 1). This confirmed the exclusion of YAP from the nuclei both of NE (PAX6+) cells and of the emerging neural-crest cells (SOX10+; Figure 2D). YAP was most notably present in the nuclei of cells expressing the early epidermal marker keratin 18 (KRT18; Figure 2E).

Given that YAP activity is enriched first in undifferentiated NNE and subsequently in epidermis, we inquired whether YAP signaling stimulates their differentiation. Taking advantage of a protocol for the direct differentiation of NC (Tchieu et al., 2017), we produced SOX10+ colonies with only sparse KRT18+ cells (Figure 3—figure supplement 1A). The administration of TRULI, which enhanced YAP activity (Figure 1E and Figure 1—figure supplement 2), resulted in the complete loss of NC-like SOX10+ colonies and a significant increase in KRT18 expression (Figure 3—figure supplement 1A). Consistent with these observations, in a converse experiment TRULI treatment boosted KRT18 expression in an epidermal-differentiation protocol (Figure 3—figure supplement 1B; Tchieu et al., 2017). Furthermore, TRULI-treated neuruloids displayed increased differentiation toward epidermis and a reduction in SOX10+ cells (Figure 3). Surprisingly, TRULI treatment also precluded the closure of the central PAX6+ domain, the simulacrum of the neural tube, despite its being devoid of detectable YAP (Figure 3).

Figure 3 with 1 supplement see all
Effect of sustained YAP activation on neural crest and neural epithelium.

Immunofluorescence images of D7 WT neuruloids demonstrate that treatment with 10 µM TRULI enhances the expression of neural ectoderm marked by PAX6 and of epidermis marked by KRT18 at the expense of NC labeled by SOX10. The plots quantify the fractions of the areas of several colonies marked by PAX6 and KRT18 (as normalized to DAPI), as well as the radial distribution of SOX10. ****, p<0.0001 in an unpaired t-test comparing untreated (control, 12 colonies analyzed) and TRULI-treated samples (TRULI, 16 colonies analyzed).

These experiments highlight the role of YAP in an in vitro model of human neurulation and suggest that the protein is dynamically regulated through canonical Hippo signaling during the specification of ectodermal lineages. Following an initial downregulation in ectodermal cells, the expression of YAP protein is induced by BMP4 stimulation and its activity supports the induction of the NNE lineage. YAP subsequently contributes directly to the differentiation of NNE by repressing the development of the NC lineage and promoting the emergence of epidermal cells. Excessive YAP activity therefore affects the balance in specification of NC and epidermis and hinders the ability of the central NE domain to fully compact.

Developing HD neuruloids display increased YAP activity

HD is caused by an expansion of CAG repeats in the Huntington locus (HTT). The development of HD can be modeled in RUES2 isogenic lines that are engineered to introduce CAG expansion, generating a unique phenotypic signature in HD-neuruloids (Haremaki et al., 2019). Using this approach, we characterized the phenotype of HD-neuruloids made from RUES2 bearing 56 CAG repeats. Interestingly, HD-neuruloids generate the same signature as TRULI-treated neuruloids: both fail to display closure of the central PAX6+ area (Figure 3). Intrigued by the similarities between the two phenotypes, and in view of the potential roles of YAP in human ectodermal differentiation, we next investigated whether the HD phenotype in neuruloids stems from hyperactivity of YAP.

To directly compare the behavior of YAP in WT and HD neuruloids, we genetically engineered an HD line to express endogenously tagged YAP-GFP (Figure 1—figure supplement 1 and Figure 1—figure supplement 2). The behavior of YAP in WT and HD neuruloids was indistinguishable during the first 3 days of neural induction, when YAP was excluded from nuclei and progressively downregulated (Figure 4—figure supplement 1). Both WT and HD lines likewise upregulated YAP expression at the edges of colonies upon BMP4 stimulation. However, at D4 YAP appeared to be more enriched in nuclei at the most peripheral region of HD-neuruloids compared to WT controls (Figure 4A; Figure 4—video 1, Figure 4—video 2, Figure 4—video 3). A similar result was obtained by immunofluorescence microscopy, which confirmed elevated YAP nuclear signals in HD colonies (Figure 4B; Figure 1—figure supplement 5). Consistent with these observations, immunoblotting analysis of D4 HD neuruloids revealed a reduction in the phosphorylated form of YAP in comparison to WT controls (Figure 4C). These observations suggest increased YAP activity in early HD neuruloids.

Figure 4 with 6 supplements see all
Dysregulation of YAP localization in HD neuruloids.

(A) Fluorescent images of the same portions of living neuruloids before (D3) and 24 hr after BMP4 administration (D4) show increased nuclear YAP in HD than in WT neuruloids. (B) Top, YAP immunofluorescence images of D4 neuruloids confirm the effect. Bottom, the radial distribution of YAP nuclear signals is quantitated for 16 neuruloid colonies for each condition. (C) Immunoblot analysis of WT and HD neuruloids at D4 shows reduction of YAP phosphorylated on residue S127 (pYAP) in HD colonies, similar to that after TRULI treatment of WT colonies. Vinculin provides a loading control. (D) Left, Immunofluorescence images of D4 neuruloids demonstrate enhanced TFAP2A at the perimeters of HD colonies. Right, quantitative analysis of nuclear TFAP2A signals confirms the effect. ****, p<0.0001 in unpaired t-tests comparing WT (n=36) and HD (n=28) colonies. (E) WT neuruloids (n=13), WT neuruloids treated with 10 µM TRULI (n=23), and HD neuruloids (n=24). Left, representative immunofluorescence images of D7 neuruloids demonstrate the similar phenotypes of TRULI treatment and HD: expansion of NE (PAX6), the diminishment of NC (SOX10), and the enhancement of epidermis (KRT18). Right, quantitative analysis of the three experimental conditions showing radial distributions of the lineage markers PAX6, SOX10, and KRT18 in several colonies. For each colony, plots show the area of the PAX6+ central region as a fraction of the entire colony and the radial distance from the colony’s center to the half-maximal intensity of the SOX10 domain. Plots of the KRT18 signal normalized by DAPI labeling confirm the result. ****, p<0.0001 in unpaired t-tests comparing the three experimental conditions. HD, Huntington’s Disease.

As observed after TRULI treatment of WT RUES2 cells (Figure 1E), D4 HD neuruloids displayed more TFAP2A at the edges of colonies (Figure 4D; Figure 4—figure supplement 2). This observation implies that increased YAP activity in early HD neuruloids has early and direct consequences for fate acquisition in the developing NNE. Consistent with elevated YAP activity, by D7, both HD neuruloids and TRULI-treated WT neuruloids displayed a remarkably expanded epidermal lineage and a reduction in the neural-crest population, as well as a failure in NE compaction (Figure 4E).

These results indicate that neuruloids obtained from hESCs carrying an HD mutation display elevated YAP activity. Consistent with our observation that YAP activity regulates NNE and epidermal formation, at D4, the HD neuruloids demonstrate more robust induction of NNE, which results by D7 in significant expansion of the epidermis at the expense of NC and in incomplete closure of the central NE domain.

Neural ectoderm of HD-neuruloids displays ectopic YAP activity

Because we observed elevated YAP activity as early as D4, we characterized this intermediate state by single-cell transcriptomic analysis. The expression profiles of lineage-marker genes in this data set allowed us to annotate the various cell populations (Figure 5—figure supplement 1A). As expected, PAX6 and TFAP2A were mutually exclusive and identified NE and NNE, respectively (Figure 5—figure supplement 1B). The NNE cell cluster could be subdivided into two subpopulations: NC progenitors expressing FOXD3 and early epidermis expressing KRT18. These populations recapitulated the three major human ectodermal lineages: NE, NC, and epidermis (Figure 5—figure supplement 1C and Figure 5—figure supplement 2).

Using the cell type-specific markers described above to identify the progenitors of the major ectodermal lineages, we employed scRNA-seq to assess their relative levels of YAP activity. YAP and key Hippo pathway components were expressed in all three lineages, most strongly in NC and epidermis (Figure 5A and B and Figure 5—figure supplement 3). However, the expression levels of YAP target genes, such as CTGF, TAGLN, and TUBB6, were much higher in epidermis than in the other ectodermal lineages (Figure 5A). To confirm these observations at a whole-genome scale, we analyzed the expression of 364 known direct YAP targets (Zanconato et al., 2015). The majority of these targets were significantly enriched in early epidermal lineage in comparison to other components of D4 neuruloid colonies (Figure 5B; Figure 5—figure supplement 4). These results confirm our initial observation in WT neuruloids that YAP activity is regulated in the ectodermal lineage and predominantly active in the epidermis lineage (Figures 2E and 3, and Figure 3—figure supplement 1).

Figure 5 with 7 supplements see all
Expression of YAP target genes in WT and HD neuruloids.

(A) Violin plots show the expression of YAP and three representative target genes in the three clusters representing the main ectodermal lineages from scRNA-seq analysis of D4 neuruloids. Expression levels are normalized counts, calculated by Seurat for each gene and plotted on a logarithmic scale. (B) A volcano plot shows the greater expression of several YAP target genes in epidermis compared to the remainder of the neuruloid. (C) An analysis of differential gene expression from scRNA-seq data shows upregulation of YAP target genes (red) in HD with respect to WT neuruloids. (D) Violin plots show the expression of three representative YAP target genes in the three lineage clusters from D4 WT and HD neuruloids. The color code is: neural crest (NC), red; neural ectoderm (NE), blue; epidermis (E), yellow; and unidentified (NA), white. The augmented expression of YAP target genes is more pronounced in the nonepidermal lineages. (E) Gene-set enrichment analysis of YAP target genes confirms the effect. (F) Analysis by uniform manifold approximation and projection (UMAP) shows the ectopic enhancement of a representative YAP target, TUBB6, in D4 WT and HD neuruloids. Full statistics are provided in Figure 5—figure supplement 5. HD, Huntington’s Disease.

We next used the scRNA-seq data to compare the molecular profiles of D4 early progenitors of NE, NC, and epidermis in WT and HD-neuruloids. Upon performing an analysis of differential gene expression, we ascertained that the majority of YAP target genes were significantly upregulated in HD compared to WT neuruloids (Figure 5C). This increased expression of YAP target genes was not observed in the epidermal lineage, for which YAP was highly active in both WT and HD-neuruloids. Instead, YAP targets were ectopically activated in the NC and NE lineages of HD neuruloids by comparison to the WT counterparts (Figure 5D). To confirm this observation, we performed gene set-enrichment analyses on a gene set consisting of previously identified YAP target genes (Zanconato et al., 2015). In agreement with the analysis of differential gene expression, this approach demonstrated a significant increase in the expression of YAP targets in NC and especially NE lineages of D4 HD neuruloids (Figure 5E). At higher resolution, the analysis showed that YAP targets were significantly upregulated in the NE population of D4 HD neuruloids, whereas the upregulation in NNE was not significant (Figure 5E). Within the NNE lineage, only the NC cluster displayed a significant upregulation of YAP transcriptional activity. This phenomenon was well illustrated by the behavior of the YAP target gene TUBB6, which was normally expressed specifically in the early epidermal lineage but became active throughout the HD neuruloids (Figure 5F).

These results confirm that HD neuruloids display higher YAP activity during their self-organization. The data also reveal that such HD-associated activation of YAP does not directly affect the epidermal lineage, in which YAP is endogenously active, but primarily perturbs NE and NC, in which YAP becomes ectopically active as a result of the HD mutation.

Effects of HD mutation and YAP activation on cell division rate

Because the Hippo pathway is known to regulate the cell cycle (Totaro et al., 2018; Zanconato et al., 2015), we sought to test whether the hyperactivation of YAP is accompanied by an increase in the rate of cell division in HD neuruloids. We compared the expression of phosphohistone H3 (pH3; J.-Y. Kim et al., 2017) in WT and HD neuruloids, in the absence or presence of TRULI, and determined the number of mitotic cells at different times (D4–D7; Figure 4—figure supplement 3). Enumeration of the mitotic nuclei in the developing neuruloids revealed that YAP activation by TRULI results in an increased proliferation rate, especially at the latest times (D6 and D7). A comparable but less profound effect appeared in HD neuruloids, which proliferated slightly more than WT cells. This result is consistent with a direct biological effect of YAP hyperactivation in HD neuruloids. The finding is also in agreement with reports showing that human cells carrying CAG expansions at the HTT locus display dysregulated polarity in the cell division of neural progenitors (Ruzo et al., 2018; Zhang et al., 2019) and that immortalized fibroblasts derived from HD patients show an increase in proliferation (Hung et al., 2018).

The HD phenotype in neuruloids results from ectopic YAP activation

In view of the increased YAP activity in HD-neuruloids and the associated phenotypic consequences, we inquired whether inhibition of YAP transcriptional activity could rescue the HD phenotype. To block YAP activity, we used verteporfin, which prevents the interaction between YAP and TEADs and thereby inhibits the transcription of target genes (Liu-Chittenden et al., 2012). In agreement with the observation that a minimal level of YAP activity is required for ectodermal induction (Giraldez et al., 2021), administration of verteporfin during the initial 3 days of differentiation resulted in cell death and detachment in both WT and HD samples. In conjunction with BMP4 induction, however, treatment with verteporfin from D3 was not toxic and did not affect the neuruloid phenotype of WT cells (Figure 6A–C; Figure 6—figure supplement 1). This indicates that high level of YAP activity may be dispensable for epidermal specification.

Figure 6 with 1 supplement see all
Perturbation of YAP activity in WT and HD neuruloids.

(A) Immunofluorescence images of D7 neuruloids show that the expansion of NE (PAX6, blue) at the expense of NC (SOX10, red) after exposure to 10 µM TRULI or in HD cells. Treatment with 0.3 µM verteporfin has no effect on WT colonies but partially rescues the effect of HD. (B) Side views portray neuruloids under the conditions used in (A). (C) The ratios of PAX6+ areas to control values under various conditions confirm the similarity of TRULI-treated WT neuruloids to HD neuruloids and the suppressive effect of verteporfin (WT colonies, n=36; WT+TRULI, n=36; HD, n=35). Rescue of this HD phenotype is stronger for early than for late exposure to verteporfin (HD, n=60, HD+VP D3–D7, n=35; HD+VP D5–D7, n=36; HD+VP D3–D5, n=25). ****, p<0.0001; ns, p>0.05 in unpaired t-tests comparing the different experimental conditions. (D) In a model of neurulation, YAP activity (green) is posited to favor nonneuronal fates, and hyperactivity (red)—either from TRULI treatment or HD—yields characteristic abnormalities. (E) A diagram illustrates the structure of a mature neuruloid and the effects on its architecture of YAP activation or HD mutation. HD, Huntington’s Disease; NE, neuronal ectoderm; NNE, nonneuronal ectoderm.

In D7 HD-neuruloids, administration of verteporfin partially rescued aspects of the HD phenotype. Although the extended epidermal population observed in HD samples was maintained, the inhibition of YAP activity partially restored the NC (SOX10+) lineage and the condensation of the central NE (PAX6+) domain (Figure 6A–C; Figure 6—figure supplement 1). This result is in agreement with the observation that in D4 HD-neuruloids, YAP target genes were significantly upregulated in the precursors of NC and NE, but not in the progenitors of the epidermal lineage (Figure 5).

Because YAP activity was elevated during the maturation of HD-neuruloids from D4, we sought to determine the period during which the inhibition of YAP transcriptional activity was most important for rescuing the closure of the central PAX6+ domain. We observed that verteporfin treatment rescued the HD-associated NE expansion if administrated together with BMP4 at D3, whereas it was unable to rescue the phenotype if added after D5 (Figure 6C).

These results indicate that the ectopic activity of YAP in HD neuruloids contributes to the malformation of their central PAX6 domains and that the effect is exerted early in neuruloid development.


In numerous organisms and a variety of tissues, the Hippo pathway plays important roles in development, homeostasis, and regeneration (Moya and Halder, 2019). Although exploring the role of this pathway during human development remains a challenge, organoid cultures derived from hESCs offer simplified simulacra for investigation. Here, we have identified YAP as an important determinant in neurulation, during which the protein’s activity is controlled—at least in part—by the Hippo pathway. Our data suggest that YAP plays a role in the specification of early ectodermal lineages, first influencing the differentiation between NNE and NE, and then between epidermis and NC. Because YAP transcriptional activity is already robust at D4 in precursors of the epidermis, the Hippo pathway might play an early role in the specification of NNE during neurulation (Figure 6D).

In addition to the unbalanced differentiation of the NNE, YAP activation also results in the failure of the central NE domain to properly close into a compact structure (Figure 6E). Future investigations will determine whether this phenotype is a cell-intrinsic result of the ectopic YAP activation in the NE lineage, or is instead an indirect consequence of the lack of the NC lineage at its margin, which might be required to provide structural support for the closure of the NE domain. This second scenario would be consistent with a recent study showing that both NE and NNE contribute to the folding morphogenesis during human neurulation (Karzbrun et al., 2021).

In line with previous reports (Yao et al., 2014; Huang et al., 2016), our results illustrate a reciprocal relationship between Hippo-YAP and BMP4-SAMD1/5 signaling during the development of the nervous system. In particular, YAP expression rises upon BMP4 stimulation, and YAP activation in turn enhances the cellular response to BMP4 at various stages: initially by augmenting BMP4-dependent NNE induction, and later by favoring the specification of epidermis, which is known to occur at a high BMP4 concentration (Wilson and Hemmati-Brivanlou, 1995).

Earlier reports showed that YAP is involved in various stages of NC development (Zhao et al., 2021), including the proliferation of NC precursors in animal models such as Xenopus (Gee et al., 2011). Moreover, YAP has been associated with stem cell-derived NC specification in a BMP4-independent manner in vitro (Hindley et al., 2016). These reports contrast with our finding that, in the context of BMP4 induction, excessive YAP activity can skew NNE specification toward an epidermal lineage at the expense of NC. These differences might stem from an epistatic relationship between the Hippo-YAP and BMP pathways during human neurulation, when YAP activity could sensitize cells to BMP stimuli.

In agreement with recent reports showing that YAP is required for early ectodermal specification (Giraldez et al., 2021), the pharmacological inhibition of YAP transcriptional activity with verteporfin during the early phase of neural induction (D0–D3) results in cell death. However, subsequent administration of verteporfin is inconsequential for the generation of WT neuruloids (Figure 6; Figure 6—figure supplement 1). This result indicates that YAP can influence ectodermal specification during neurulation, perhaps by boosting BMP4 signaling, but its activity is not required.

Noting the similarities between TRULI-treated neuruloids and those bearing HD mutations (Haremaki et al., 2019), we explored the potential contribution of YAP dysregulation to the HD phenotype. HD-neuruloids displayed altered YAP regulation that resulted in ectopic activation of its transcriptional program, especially within the NE lineage. This HD-associated YAP hyperactivity results in an unbalanced differentiation of the NNE lineage as well as increased cell proliferation and might contribute directly to the failure of compaction in the central NE, even though this structure is devoid of YAP detectable by immunofluorescence.

Although individuals with HD have not been reported to experience a failure in folding of the neural tube or effects on fertility rate, there is a large body of evidence that connects HTT activity to developmental events. First, homozygote loss of function in the mouse leads to embryonic lethality at the onset of gastrulation, demonstrating that the function of the protein is necessary for early embryogenesis (Nasir et al., 1995). Consistent with that result, no human of the HTT−/− genotype is ever born. Second, in human embryos, the HD mutation impacts development as early as gestational week 13 (Barnat et al., 2020). Moreover, CAG expansion in HD patients causes early fetal anatomical abnormalities including an effect on ventricular volume (Hobbs et al., 2010). The earliest postnatal death due to HD in humans has been reported at 18 months of age (Nicolas et al., 2011). Perhaps the most stringent evidence linking the causality of HD to early embryogenesis is the fact that a pulse of expression of expanded CAG-HTT in a WT mouse leads to the emergence of HD symptoms in the adult (Molero et al., 2016; Wiatr et al., 2018). Third, guided differentiation of hESCs toward mature cortical neurons, self-organizing cerebroids, gastruloids, and neuruloids all point to CAG-length-dependent embryonic phenotypes (Galgoczi et al., 2021; Haremaki et al., 2019; Ruzo et al., 2018). Our study demonstrates that HTT-CAG expansion affects a model for human neurulation and that this phenotype is associated with the dysregulation of the Hippo pathway, with an increase of YAP activity early at D4 and later reduction by D7.

Owing to homeostatic and compensatory mechanisms, development in vivo is likely to be more robust than that in vitro. As a result, the neuruloid offers a sensitive assay for subtle phenomena that might otherwise remain hidden. Because our data suggest that neurulation is perturbed in HD, exploring how the developing human embryo compensates for this challenge could yield insight into the dysfunction manifested postnatally.

Several studies support the role for YAP in the pathophysiology of HD. Postmortem cortical samples from HD patients display diminished YAP activity. Moreover, YAP activators ameliorate symptoms in HD mice and normalize the phenotypes of cultured cells (Mao et al., 2016; Mueller et al., 2018). In our data, YAP activation at D4 was elevated in HD neuruloids compared to WT controls, but at D7, YAP transcription was instead diminished (Figure 5—figure supplement 6). This reversal might reflect compensation for increased YAP activity so that development could proceed normally. The reversal might alternatively represent an end state of failed development. It will be interesting to investigate whether YAP hyperactivation during early neurulation leads to hypoactivity in mature neurons. Lats1/2 knockout mice demonstrate that Hippo signaling later regulates the number and differentiation of neural progenitor (Lavado et al., 2018), and postmortem analysis of HD patients shows significantly increased proliferation of subependymal neural progenitors (Curtis et al., 2005). These results suggest that the effects of HTT mutations on this process through YAP dysregulation bear on the pathophysiology of the disease.

Our study leaves open the question of the connection between Hippo signaling and HD. Huntingtin protein is known to play a role in vesicle trafficking and establishing apical-basal polarity (Caviston and Holzbaur, 2009; Galgoczi et al., 2021; Saudou and Humbert, 2016), a prime regulator of Hippo signaling (Piccolo et al., 2014). The protein is also involved in the establishment and maintenance of intact epithelia, a function that is compromised by HD mutations (Galgoczi et al., 2021). Loss of intercellular adhesion might contribute directly to dysregulation of the Hippo pathway, reflected here as increased YAP activity. In this scenario, it is possible that CAG expansion at the HTT locus effects cell-cell contact, disrupting proper epithelial integrity and in turn dysregulating the Hippo pathway. Furthermore, lack of proper epithelial polarity could also result in the mislocalization of morphogen receptors and thus in increased sensitivity of BMP4/SMAD1/5 signaling, which in turn could affect the Hippo pathway. Future investigations of these mechanisms will reveal the molecular consequences of HD mutations and how mechanical cues interact with morphogenic signaling during embryonic development.

Materials and methods

Cell line

Request a detailed protocol

This work was based on the RUES2 (National Institutes of Health Human Embryonic Stem Cell Registry #0013) human ES cell line, the identity of which was confirmed by STR profiling (performed by Cell Line Genetics). The cells were also tested for mycoplasma and resulted negative.

Cell culture

Request a detailed protocol

Cells were grown in a HUESM medium that was conditioned with mouse embryonic fibroblasts and supplemented with 20 ng/ml bFGF (MEF-CM; Deglincerti et al., 2016). Cells were grown on tissue culture dishes coated with Geltrex solution (Life Technologies) and tested for mycoplasma at 2-month intervals.

Generation of YAP-GFP hESC lines

Request a detailed protocol

Carboxy-terminal tagging of endogenous YAP alleles with GFP was obtained by using a donor plasmid, which was kindly donated by the Liphardt laboratory (Franklin et al., 2020). This contains an upstream homology arm approximately 1  kB in length; a cassette encoding GFP, a P2A site, puromycin resistance, and a stop codon; and a downstream homology arm also about 1 kB long. RUES2 (WT) and isogenic 56CAG (HD) hESC lines were co-transfected with Px330-Cas9-sgYAP (sgRNA sequence targeting YAP locus: TTAGAATTCAGTCTGCCTGA), donor YAP-eGFP-P2A-puromycin resistance, ePB-H2B-mCherry-BSDa, and transposase. Nucleofection was performed with program B-016 on an Amaxa Nucleofector II (Lonza). Cells were then grown for 10 days under selection by 1 μg/ml puromycin and 10 μg/ml blasticidin. Multiple clones from each line were selected for characterization by PCR genotyping with the following oligonucleotides:

  • GFP integration:



  • Heterozygotic versus homozygotic:



Neuruloid culture

Request a detailed protocol

To generate neuruloids (Haremaki et al., 2019), we coated micropatterned glass coverslips (CYTOO Arena A, Arena 500 A, and Arena EMB A) for 3 hr at 37°C with 10 μg/ml recombinant laminin-521 (BioLamina, LN521-05) diluted in PBS+/+ (Gibco). Single-cell suspensions were then incubated for 3 hr at 37°C in HUESM medium supplemented with 20 ng/ml bFGF and 10 μM Rock inhibitor Y27632. The micropattern culture was then washed once with PBS+/+ and incubated with HUESM with 10 μM SB431542 and 0.2 μM LDN 193189. On D3, the medium was replaced with HUESM containing 10 μM SB431542 and 3 ng/ml BMP4. On D5, the medium was replaced with the same fresh medium and then incubated until D7.

NC and epidermis differentiation

Request a detailed protocol

Direct differentiation of NC was performed by a published method (Tchieu et al., 2017). RUES2 hESCs were cultured for 3 days in E6 medium (STEMCELL, 05946) containing 1 ng/ml BMP4, 10 μM SB431542, and 600 nM CHIR, then transferred for 4 days to 10 μM SB431542 and 1.5 μM CHIR.

Induction of epidermis was conducted on Transwell (Corning, CLS3413). RUES2 hESCs were cultured for 3 days in E6 medium (STEMCELL, 05946) containing 10 μM SB431542 (top of the transwell) and 10 μM SB431542 and 10 ng/ml BMP4 (bottom of the transwell). After the media had been replaced with 10 μM SB431542 and 0.2 μM LDN193189 (top and bottom), the cells were incubated for an additional 4 days.


View detailed protocol

Micropatterned coverslips were fixed with 4% paraformaldehyde (Electron Microscopy Sciences 15713) in warm medium for 30 min, rinsed three times with PBS−/−, and blocked and permeabilized for 30 min with 3% normal donkey serum (Jackson ImmunoResearch 017-000-121) and 0.5% Triton X-100 (Sigma-Aldrich 93443) in PBS−/−. Specimens were incubated with primary antibodies for 1.5 hr at room temperature, washed three times for 5 min each in PBS−/−, incubated with secondary antibodies conjugated with Alexa 488, Alexa 555, Alexa 594, or Alexa 647 (Molecular Probes) at 1/1000 dilution. After 30 min incubation with 100 ng/ml 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific D1306), specimens were washed three times with PBS−/−. Coverslips were mounted on slides using ProLong Gold antifade mounting medium (Molecular Probes P36934).

  • Antibodies used:

  • YAP (Santa Cruz Biotechnology 101199);

  • TFAP2A (DSHB 3B5 concentrate);

  • PAX6 (BD Biosciences 561462);

  • SOX10 (R&D Systems AF2864); and

  • KRT18 (Abcam ab194130).

Imaging and analysis

Request a detailed protocol

Confocal images were acquired on a Zeiss Inverted LSM 780 laser-scanning confocal microscope with a 10×, 20×, or 40× water-immersion objective. YAP-GFP Live reporter imaging was performed with a Zeiss AxioObserver z1 or spinning-disk microscope (Cell Voyager CV1000, Yokogawa).

For the acquisition of radial profiles, images were preprocessed to display the maximum-intensity projection (MIP) of at least four z-stacks. MIP images were subsequently imported into Python (czifile 2019.7.2). Individual colonies were cropped, and the radial intensity profile of fluorescence was calculated for each image starting from the center. Results were reported in arbitrary fluorescence units.

For quantitative analysis of single cells (Figure 2D), individual nuclei were segmented in the DAPI channel in each z-slice of a confocal image by a published procedure (Etoc et al., 2016). Twelve images representative of the data were selected to train Ilastik, an interactive learning and segmentation toolkit, to classify each pixel into two categories: nucleus or background. The pixels in the nucleus class were then used to create a binary mask. The original z-slice image was then processed to detect seeds based on a sphere filter with a manually set threshold. Watershedding was then applied from the defined seeds into the mask of the nuclei as defined previously by Ilastik, resulting in a set of segmented nuclei. The median intensity of PAX6, SOX10, or YAP immunofluorescence was then measured for each segmented nucleus.

Single-cell RNA sequencing

Request a detailed protocol

Micropatterned glass coverslips with neuruloids 500 μm in diameter were grown in 3 ng/ml BMP4 from RUES2 hESCs and the isogenic 56CAG HD line. On D4, approximately half of the neuruloids on each coverslip were scraped off and treated for 10 min at 37°C with Accutase (Stemcell Technologies). The remaining neuruloids were fixed for immunofluorescence analysis as a quality control. After dissociation, the cells were washed three times in PBS−/− (Gibco) with 0.04% bovine serum albumin and strained through a 40-μm tip strainer (Flowmi 136800040). The number and viability of cells were determined by exclusion of trypan blue on a Countess II automated cell counter. The samples were separately loaded for capture with the Chromium System using Single Cell 3' v2 reagents (10× Genomics). Following cell capture and lysis, cDNA was synthesized and amplified according to the manufacturer’s instructions. The resulting libraries were sequenced on NovaSeq 6000 SP flowcell. The Cell Ranger software pipeline (v2.0.2) was used to create FASTQ files that aligned to the hg19 genome with default parameters. Filtered gene-expression matrices of genes versus detected barcodes (cells) with counts of unique molecular identifiers were generated and used for subsequent analyses. These data are available through NCBI accession number GSE182074.

Single-cell RNA analysis

Request a detailed protocol

The sequencing data were analyzed using Cellranger count (v3.0.2) and aggregated with the Aggr function and default settings. The aggregated datasets were processed with Seurat (v3.2.3) (Stuart et al., 2019). Quality control and filtering were performed with Scater Bioconductor (v1.16.1) to identify and remove poor-quality cells characterized by low library sizes, low numbers of expressed genes, and low or high numbers of mitochondrial reads (McCarthy et al., 2017). Following a cutoff step (counts >6000; genes >2600; 3% <mitochondrial genes <11 %), we obtained about 8000 cells in WT and roughly 6000 cells for HD. Counts of genes in each cell were normalized and log10-transformed. In order to merge the data sets using Seurat’s FindIntegrationAnchors and IntegrateData methods, we identified integration anchors for the WT and HD datasets by means of the top 2000 variable genes and first 20 principal components. The cell cycle phase was estimated by Seurat with default setting and data were rescaled to remove the effects of cell cycle and mitochondrial transcript expression. Clustering of cell was performed with Seurat’s findClusters function by use of the first 20 principal components and with two resolutions—0.5 and 0.1—to yield sets of seven clusters and two clusters, respectively. The seven-cluster set was further aggregated by manual curation of cell-type specific markers into four clusters. Uniform manifold approximation and projection (UMAP) dimension reduction implemented within Seurat was applied to the normalized, integrated data and the cluster sets projected and visualized on the resulting UMAP coordinates. Visualization of normalized expression values on UMAP coordinates and as violin plots were performed using Seurat’s FeaturePlot and VlnPlot, respectively. Differential gene expression and analysis between clusters and samples were performed by MAST (v1.8.2; Finak et al., 2015). YAP targets were retrieved from msigDB C6 gene sets and enrichment with differential expression tests assessed by single-cell GSEA implemented within MAST.


Request a detailed protocol

Protein samples were resolved in 4%–15% Mini-PROTEAN TGX Stain-Free Gels (for HTT: NuPAGE 3%–8% Tris-Acetate Protein Gels), then transferred to PVDF membranes and incubated with primary antibodies overnight at 4°C followed by secondary antibodies at RT for 1 hr. Pierce ECL Western Blotting Substrate or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) was used for the detection of peroxidase activity.

  • Antibodies used:

  • Vinculin (MilliporeSigma 05-386);

  • GFP (Thermo Fisher Scientific A 11122)

  • tYAP (Santa Cruz Biotechnology sc 101199)

  • phYAP (CST 4911 S); and

  • HTT (MilliporeSigma mab2166).

Data availability

Sequencing data have been deposited in GEO under accession code GSE182074.

The following data sets were generated
    1. Piccolo FM
    2. De Santis R
    3. Brivanlou AH
    4. Luo J
    5. Carroll TS
    (2022) NCBI Gene Expression Omnibus
    ID GSE182074. scRNAseq profile of Day 4 Neurloids derived from WT and HD isogenic hESC lines.


Decision letter

  1. Marianne Bronner
    Reviewing Editor; California Institute of Technology, Division of Biology and Biological Engineering, Pasadena, United States
  2. Marianne E Bronner
    Senior Editor; California Institute of Technology, United States
  3. Raman M Das
    Reviewer; University of Manchester, United Kingdom

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Role of YAP in early ectodermal specification and a Huntington's Disease model of human neurulation" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Marianne Bronner as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Raman M Das (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. While the reviewers see merit in the work, they also recommend extensive revisions to improve quantitation and clarify the results. The full reviews are enclosed to help in the revision process.

Essential revisions:

1. The manuscript requires additional quantifications and an expanded discussion.

2. The authors should look at upstream effectors of the Hippo pathway and assess the effects of YAP activity on proliferation.

3. The authors must resolve the inconsistencies in the model and improve quantification strategies, as detailed in the full reviews below.

Reviewer #1 (Recommendations for the authors):

– In Figure 5 the authors present the upregulation of YAP target genes in the epidermal lineage. The dataset of 364 genes employed for this analysis (Zanconato et al., 2015) was developed in epithelial-like breast cancer cells and may not represent the downstream targets of Hippo signaling in the developing ectoderm.

– Introduction and discussion are insufficiently referenced.

– Statistics for violin plots in figures 5, S6, S7, S9 and for box plots in Figure 2D should be included.

– Legends of Fig6 and FigS8 indicate "PAX10" expression in NC instead of SOX10.

– Supplemental figure 2A and 2B do not correspond to the description in the figure and text.

Reviewer #2 (Recommendations for the authors):

This manuscript identifies YAP signalling as key player in lineage determination during development of early human ectoderm. Additionally, the authors show that neuroloids generated using cells engineered to express penetrant levels of CAG repeats in the HTT gene display aberrant YAP signalling during ectodermal specification and that this phenotype can be partially rescued by inhibition of this pathway. The similarity of the YAP-activated neuroloids and the HD neuroloids is striking and important. However, the study should be improved by providing clear mechanistic experiments to definitively demonstrate the role of YAP signalling in NNE specification and in HD neuroloids.

– It could also be useful to look at various proteins within the Hippo pathway to show dynamics across the colony over neural induction.

– In figure 1E, it is hard to distinguish the localization of YAP within the nucleus – it would be useful to show higher resolution images with H2B-Cherry cells like in SFig2, or simply fixed-and-stained for YAP compared to DAPI to show redistribution of YAP over neural induction. Quantification of colocalization within the nucleus is needed.

– It would be helpful if the authors could show higher resolution still images to document what they mean by "nuclear cytoplasmic flux." Right now the data is rather unconvincing that it is shuttling out of the nucleus. Quantification of fluorescence intensities within the nucleus compared to outside of the cell would be needed to show that YAP is indeed shuttling outside the nucleus. Would it be possible to use a cell membrane marker to show that this YAP shuttling conserves the protein over time – as in, all of the accounted for nuclear YAP is maintained and pushed to the cytoplasm?

– Quantifications of fluorescence intensities of the blots would be useful to measure increases in expression.

– Statistics are needed for the change in expression levels in 2C – is this a significant change? Also what are the Y axes?

– In 2D they describe nuclear YAP exclusion from the nucleus but it is difficult to discern where exactly the signal is coming from without a DAPI channel or zoomed images of nuclear exclusion. It would be also interesting to describe the extent of nuclear exclusion and if that correlates with KRT18 expression. Does the more nuclear YAP dictate how much KRT18 expression there is?

– Similar quantifications of cytoplasmic/nuclear expression is needed for Figure 4.

– The authors describe that verteporfin results in loss of cell adhesion in both WT and HD samples but do not show images describing this phenomenon. As a control it would be useful to show that adhesions are maintained over the course of neuroloid development with and without Verteporfin treatment.

Perhaps most importantly, the authors demonstrate that the YAP signature is highly enriched in the NE cluster in HD neuroloids, however, their staining and previous figures show little to no YAP localisation within the PAX6+ NE.

Significant extra analysis of the downstream ramifications of aberrantly increased YAP signalling in the NE is necessary.

The authors claim that increased YAP activity leads to increased NNE and epidermal cell commitment but this is not reflected in the scRNAseq data (Figure 5). It would be valuable to include more robust identification of lineages that includes multiple markers for each lineage (a heat map will illustrate this nicely).

– While the authors use TRULI and Verteporfin to study the effects of YAP on neural induction, it would be worthwhile to visualize via fix-and-stains other members of the HIPPO pathway (and especially members downstream of YAP) to show if there are similar effects of nuclear exclusion in WT and HD neuruloids.

Reviewer #3 (Recommendations for the authors):

The authors report exclusion of Yap from nuclei at D3, when neural induction occurs. Is this indicative of initiation of Hippo signalling? Are the upstream stimuli that may lead to Hippo activation here known? Perhaps the authors could speculate on this a bit more in the discussion? Also, YAP is again upregulated upon BMP stimulation at D4, but is BMP directly activating Hippo signalling here?

Although of considerable interest, the connection between human neurulation and Huntington's Disease could be improved a bit. I wonder if the authors could expand on their discussion of the similarities between TRULI treatment and HD neuruloids. This is a particularly intriguing finding, as the authors state, since HD symptoms manifest only in adulthood. Are embryos carrying the htt mutation less likely to complete development and is there an effect in fertility rates? It would also be interesting if the authors could comment on juvenile HD, which has a much earlier onset of symptoms.

Specific comments:

1. Overall, the authors have not presented key experimental details such as the number of neuruloids assessed for each experiment. This information will need to be added to improve confidence in the conclusions.

2. Perhaps the presentation of Video 1 could be improved to better display the nuclear-cytoplasmic flux of YAP. An enlarged region of representative cells undergoing said flux would be a welcome addition here as would slowing down the video.

3. The data presented in supplementary figure 2 is meant to show the effect of cell density and TRULI treatment on YAP localisation. However, this figure is difficult to interpret as all the panes appear to have similar YAP expression and localisation. Has this data been quantified? An indication of the percentages of cells with nuclear or cytoplasmic YAP would be useful here as would be zoomed images of representative cells.

4. Figure 2D is difficult to interpret as presented here. For example, it is not clear if any Pax6 positive cells are also expressing YAP. It would be useful to split the channels here.

5. Although it is clear that YAP is present in KRT18 nuclei (Figure 2E), there are a number of other cells in the region that are KRT18 negative but still present nuclear YAP. Are these cells also destined to acquire epidermal fate?

6. On page 6 and in following sections, the authors state that administration of TRULI leads to enhanced YAP activity. However, the data only really demonstrates nuclear localisation rather than activity. Granted, the later scRNA seq experiments then confirm this finding. Perhaps this statement could be toned down here.

7. The control images shown in figure 3 appear to also possess a lumen, albeit this is smaller than the lumen of the TRULI treated neuruloids. Is this indicative of slower neurulation compared to controls? Should neurulation be complete at the stages shown? I assume this is the case as the images shown in figure 2D show fully closed lumens.

8. The authors report that administration of verteporfin in the first three days of culture leads to loss of cell adhesion, but there is not data shown to support this.

9. The methods section should also include a section on immunoblotting.

Author response

Essential revisions:

1. The manuscript requires additional quantifications and an expanded discussion.

We have now added quantification of nuclear YAP accumulation and included additional quantification of live YAP-GFP in pluripotency. The discussion has also been expanded to include a potential connection between the HD-neuruloid phenotype and the pathophysiology of HD.

2. The authors should look at upstream effectors of the Hippo pathway and assess the effects of YAP activity on proliferation.

We have addressed below in our response to reviewers, our analysis of upstream components derived from our data that indicate expression of all canonical components of the Hippo pathway at comparable expression levels across ectodermal lineages and between WT and HD samples. We also expand on our hypothesis regarding the connection between HD and YAP dysregulation as well as current technical limitations in further speculations regarding the upstream effectors of the Hippo pathway. We have also assessed, by two independent means the effects of YAP activation on the rate of cell division, using our scRNA-seq dataset at D4 to calculate the velocity of cell cycle-associated genes, and a direct count of mitotic cells at different time points during neuruloid formation. This analysis is now presented in a new supplemental figure (Figure 4—figure supplement 3). We show that there is an acceleration of the cell cycle associated with YAP activation or HD mutation, reinforcing our main conclusion that HD neuruloids display hyperactive YAP.

3. The authors must resolve the inconsistencies in the model and improve quantification strategies, as detailed in the full reviews below.

We have now resolved apparent inconsistencies in our model by improving our schematic on Figure 6E, and provide further clarifications throughout the manuscript. We have also added nine supplemental figures that we believe, strengthen the conclusions of our study. Quantification strategies and methods have been clarified and strengthened as requested.

Reviewer #1 (Recommendations for the authors):

– In Figure 5 the authors present the upregulation of YAP target genes in the epidermal lineage. The dataset of 364 genes employed for this analysis (Zanconato et al., 2015) was developed in epithelial-like breast cancer cells and may not represent the downstream targets of Hippo signaling in the developing ectoderm.

The reviewer is correct, the list of YAP target was established in a different context, which is not necessarily maintained here. However, we believe that this is the best approximation available to determine genes that are potentially directly regulated by YAP. Moreover, commonly cited YAP target genes are included in the dataset, which is also used in other studies (Kastan et al., 2021). Given epigenetic accessibility, the target specificity for a transcription factor is given by the promoter sequences, which do not change in different contexts. Therefore, it is true that not all 364 genes are YAP targets in this neuruloid context, but many of them are in progenitors of the epidermis lineage, which is the one that displays the strongest nuclear YAP signals.

– Introduction and discussion are insufficiently referenced.

We now added additional references to introduction and Discussion.

– Statistics for violin plots in figures 5, S6, S7, S9 and for box plots in Figure 2D should be included.

We would like to thank the reviewer for pointing this out. We have now included additional supplemental figures containing tables for the statistical analysis of scRNA-seq violin plots (Figure 5 and Figure 5—figure supplement 1 and Figure 5—figure supplement 17). Furthermore, we now include relevant statistics for the boxplot in Figure 2D.

– Legends of Fig6 and FigS8 indicate "PAX10" expression in NC instead of SOX10.

Thank you for pointing this out; we have corrected the typo.

– Supplemental figure 2A and 2B do not correspond to the description in the figure and text.

Thank you for pointing this out; we have now corrected this discrepancy.

Reviewer #2 (Recommendations for the authors):

This manuscript identifies YAP signalling as key player in lineage determination during development of early human ectoderm. Additionally, the authors show that neuroloids generated using cells engineered to express penetrant levels of CAG repeats in the HTT gene display aberrant YAP signalling during ectodermal specification and that this phenotype can be partially rescued by inhibition of this pathway. The similarity of the YAP-activated neuroloids and the HD neuroloids is striking and important. However, the study should be improved by providing clear mechanistic experiments to definitively demonstrate the role of YAP signalling in NNE specification and in HD neuroloids.

– It could also be useful to look at various proteins within the Hippo pathway to show dynamics across the colony over neural induction.

We have expanded the discussion about potential consequences of increased YAP activity and looked into the expression level of other components of the Hippo pathway across the three ectodermal lineage progenitors at D4 (Figure 5—figure supplement 3). This analysis showed that the Hippo pathway is active in all the cells at this stage. Unfortunately, antibodies for the proteins expressed by these genes did not work in our hands.

– In figure 1E, it is hard to distinguish the localization of YAP within the nucleus – it would be useful to show higher resolution images with H2B-Cherry cells like in SFig2, or simply fixed-and-stained for YAP compared to DAPI to show redistribution of YAP over neural induction. Quantification of colocalization within the nucleus is needed.

Figure 1E correspond to samples that were fixed and labeled for YAP, TFAP2A and DAPI. The DAPI signal was then used to segment individual nuclei, which allowed the measurement of the YAP signal in the nucleus of each cell. Following the reviewer’s recommendation, and to better clarify this point we now include magnified videos of live YAP-GFP;H2B-mCHerry and YAP-GFP neuruloids (D3-D4; Figure 1—video 2, Figure 1—video 3, Figure 1—video 5, Figure 1—video 6, Figure 4—video 2 and Figure 4—video 3); as well as magnified confocal images of fixed and stained (DAPI/YAP) D4 neuruloids, in both cases for WT, WT+TRULI, and HD lines (Figure 1—figure supplement 5).

– It would be helpful if the authors could show higher resolution still images to document what they mean by "nuclear cytoplasmic flux." Right now the data is rather unconvincing that it is shuttling out of the nucleus. Quantification of fluorescence intensities within the nucleus compared to outside of the cell would be needed to show that YAP is indeed shuttling outside the nucleus. Would it be possible to use a cell membrane marker to show that this YAP shuttling conserves the protein over time – as in, all of the accounted for nuclear YAP is maintained and pushed to the cytoplasm?

We apologize for the confusion from our use of the term “flux". Upon BMP4 induction, YAP is upregulated and found in the nucleus of some cell at the edge of the colony. This effect is regulated by the Hippo pathway, which when active—in terms of phosphorylation—retains YAP in the cytoplasm. Thus, TRULI (a Hippo inhibitor) increases the amount of YAP that becomes free to translocate into the nucleus (Figure 1E and Figure 1—figure supplement 5). Our focus is not with the bidirectional flux but rather the absolute measurable increase in nuclear localization upon Hippo inhibition.

We performed these analyses using confocal images of cells labeled for YAP and DAPI, using the latter to identify nuclei and then measure the amount of nuclear YAP signal, and plotted as a radial distribution. As motioned above, we have now added new supplemental material including highly magnified videos of living D3-D4 neuruloids (Figure 1—video 2, Figure 1—video 3, Figure 1—video 5, Figure 1—video 6, Figure 4—video 2 and Figure 4—video 3) as well as magnification of DAPI/YAP confocal images for WT, WT+TRULI, and HD lines (Figure 1—figure supplement 5).

– Quantifications of fluorescence intensities of the blots would be useful to measure increases in expression.

We would like to thank the reviewer for this suggestion. We now added a Supplemental Figure with quantification of the immunoblot data (Figure 1—figure supplement 4).

– Statistics are needed for the change in expression levels in 2C – is this a significant change? Also what are the Y axes?

Following the reviewer’s advice, we have now added the label for the Y axes as “cell counts", and performed two-way ANOVA and non-parametric multiple t-tests on two experiments, showing p < 0.000001 for both settings. The statistics have been added to the Figure Legend.

– In 2D they describe nuclear YAP exclusion from the nucleus but it is difficult to discern where exactly the signal is coming from without a DAPI channel or zoomed images of nuclear exclusion.

In agreement with the reviewer, a Supplementary Figure with higher magnification that increases the resolution in different channels has now been added (Figure 2—figure supplement 1).

It would be also interesting to describe the extent of nuclear exclusion and if that correlates with KRT18 expression. Does the more nuclear YAP dictate how much KRT18 expression there is?

Throughout this study KRT18 has been used as a cell-type specific marker to identify early progenitors of the epidermal lineage, in terms of YAP activity and expression. Our study does not address direct regulation of KRT18 by YAP, which is outside of the scope of this study.

– Similar quantifications of cytoplasmic/nuclear expression is needed for Figure 4.

As in Figure 1E, Figure 4B shows the fixed and labeled confocal images of D4 neuruloids (YAP/DAPI), in which the DAPI signal was used to perform nuclear segmentation and then to quantify the amount of nuclear YAP signal in WT and HD specimens.

– The authors describe that verteporfin results in loss of cell adhesion in both WT and HD samples but do not show images describing this phenomenon. As a control it would be useful to show that adhesions are maintained over the course of neuroloid development with and without Verteporfin treatment.

We apologize for the misunderstanding. Following verteporfin treatment during the first three days of the neuronal induction, the cells die and detach from the dish. This is not entirely surprising given that it has been shown that YAP activity is required for early ectodermal differentiation. We have now stated this point more clearly in the manuscript.

Perhaps most importantly, the authors demonstrate that the YAP signature is highly enriched in the NE cluster in HD neuroloids, however, their staining and previous figures show little to no YAP localisation within the PAX6+ NE.

The reviewer is correct, we were able to measure YAP activity by examining the expression of its target genes by scRNA-seq, a methodology that is far more sensitive than imaging. We conclude that the hyperactivation of YAP occurs highly in the NNE at the periphery and is very subtle in the NE at the center. However, because the level of YAP activity in NE is very low, a subtle increase results in a multifold change.

Significant extra analysis of the downstream ramifications of aberrantly increased YAP signalling in the NE is necessary.

While this might be an interesting analysis, it falls outside the scope of our study. Nevertheless, we have now included a robust analysis on the cell cycle effects of YAP activation, and cover potential implications in the Discussion.

The authors claim that increased YAP activity leads to increased NNE and epidermal cell commitment but this is not reflected in the scRNAseq data (Figure 5). It would be valuable to include more robust identification of lineages that includes multiple markers for each lineage (a heat map will illustrate this nicely).

We would like to thank the reviewer for this suggestion, which we have followed. A heatmaps of the top (100 and 20) genes that are differentially expressed most significantly across the three lineages has now been added (Figure 5—figure supplement 4).

– While the authors use TRULI and Verteporfin to study the effects of YAP on neural induction, it would be worthwhile to visualize via fix-and-stains other members of the HIPPO pathway (and especially members downstream of YAP) to show if there are similar effects of nuclear exclusion in WT and HD neuruloids.

As we show in supplemental Figure 5—figure supplement 3, the canonical components of the Hippo pathway upstream of YAP are expressed. Moreover, expression of LATS proteins in the cells where TRULY induces YAP activation suggests that at least some of the canonical Hippo signaling component are at play. Published antibodies for upstream components do not work in our hands, but even so, the non-YAP components of the Hippo pathway do not shuttle into and out of the nucleus, for their activity occurs in the cytoplasm. It is when the Hippo phosphorylation cascade is inactive, and YAP remains unphosphorylated, that YAP alone relocates from the cytoplasm to the nucleus at an increased rate.

Reviewer #3 (Recommendations for the authors):

The authors report exclusion of Yap from nuclei at D3, when neural induction occurs. Is this indicative of initiation of Hippo signalling? Are the upstream stimuli that may lead to Hippo activation here known? Perhaps the authors could speculate on this a bit more in the discussion?

Dissecting the exact upstream regulatory mechanisms of Hippo signaling in this context is very challenging, for the pathway functions as a hub for a plethora of inputs. However, our interpretation is that HD mutation results in abnormal epithelial polarity, which in turn might dysregulate the Hippo pathway. Following the reviewer’s advice, we have now extended this part of the Discussion to address this more fully.

Also, YAP is again upregulated upon BMP stimulation at D4, but is BMP directly activating Hippo signalling here?

We would like to thank the reviewer for raising this issue. The upregulation of YAP at the edge of the colony is induced by BMP4 stimulation. We have added a Supplemental Figure showing that the increase of nuclear YAP at D4 of the differentiation protocol is dependent on BMP4 stimulation (Figure 1—figure supplement 3A). Our video (Figure 1—video 1) shows that the upregulation of YAP at the edge of the colony occurs 18–20 hrs after BMP4 stimulation, suggesting that YAP expression might be directly regulated by SMAD1. To corroborate this hypothesis, we looked into a published dataset of SMAD1 ChIPseq performed in hESC (Tsancov et al., 2015), which shows that SMAD1 binds to the regulatory region of YAP and therefore could directly regulate YAP expression (Figure 1—figure supplement 3B).

Although of considerable interest, the connection between human neurulation and Huntington's Disease could be improved a bit. I wonder if the authors could expand on their discussion of the similarities between TRULI treatment and HD neuruloids. This is a particularly intriguing finding, as the authors state, since HD symptoms manifest only in adulthood. Are embryos carrying the htt mutation less likely to complete development and is there an effect in fertility rates? It would also be interesting if the authors could comment on juvenile HD, which has a much earlier onset of symptoms.

Following the reviewer’s advice, we have now expanded our Discussion to consider more widely the potential developmental implication of HD mutation, including comments on the juvenile forms of HD.

Specific comments:

1. Overall, the authors have not presented key experimental details such as the number of neuruloids assessed for each experiment. This information will need to be added to improve confidence in the conclusions.

We would like to thank the reviewer for pointing this out. We apologize for this omission and have now included the number of colonies analyzed in each experiment in the Figure Legends.

2. Perhaps the presentation of Video 1 could be improved to better display the nuclear-cytoplasmic flux of YAP. An enlarged region of representative cells undergoing said flux would be a welcome addition here as would slowing down the video.

As stated above, we apologize for the confusion created by our use of the term “flux”, which we agree can be misleading. We show that following BMP4 stimulation, YAP expression is upregulated at the edge of the colonies and sporadically localizes into the nucleus. Upon TRULI treatment or HD mutation, cells at the edge fail to retain YAP in the cytoplasm, resulting in increased nuclear YAP localization. To clarify this point, we have rephrased the term “flux” and included, as suggested, magnified and slowed videos of YAP-GFP/H2B-mCherry D3-D4 neuruloids (Figure 1—video 2, Figure 1—video 3, Figure 1—video 5, Figure 1—video 6, Figure 4—video 2 and Figure 4—video 3).

3. The data presented in supplementary figure 2 is meant to show the effect of cell density and TRULI treatment on YAP localisation. However, this figure is difficult to interpret as all the panes appear to have similar YAP expression and localisation. Has this data been quantified? An indication of the percentages of cells with nuclear or cytoplasmic YAP would be useful here as would be zoomed images of representative cells.

We would like to thank the reviewer for pointing this out. We have now performed quantitative analysis of these samples, where we calculated the ratios of YAP nuclear/cytoplasmic signals in live cell imaging. The ratios were determined by segmenting nuclei based on the H2B-mCherry channel and using an inverted nuclear mask to obtain the average cytoplasmic signal (Figure 1—figure supplement 2).

4. Figure 2D is difficult to interpret as presented here. For example, it is not clear if any Pax6 positive cells are also expressing YAP. It would be useful to split the channels here.

We would like to thank the reviewer for this suggestion. We have now added a Supplementary Figure with details of D4 to D6 neuruloids in split channels (Figure 2—figure supplement 1).

5. Although it is clear that YAP is present in KRT18 nuclei (Figure 2E), there are a number of other cells in the region that are KRT18 negative but still present nuclear YAP. Are these cells also destined to acquire epidermal fate?

The reviewer is correct. Figure 2E reports representative images of neuruloids at D5 when epidermal fate begins to emerge with few cells to expressing KRT18. We believe that all cells that display nuclear YAP at this stage will eventually become epidermis and express KRT18.

6. On page 6 and in following sections, the authors state that administration of TRULI leads to enhanced YAP activity. However, the data only really demonstrates nuclear localisation rather than activity. Granted, the later scRNA seq experiments then confirm this finding. Perhaps this statement could be toned down here.

We thank the reviewer for pointing this out. In the narrative of the manuscript, we have striven to discriminate localization of YAP from its demonstrated transcriptional activity. However, we believe that nuclear localization of YAP is a good readout of its activity, and is broadly used in the field as such. Additionally, and as the reviewer notes, we do have scRNA-seq results that show enriched activity of YAP target genes in the epidermal lineage; we also found strong YAP nuclear localization through immunohistochemistry and live imaging.

7. The control images shown in figure 3 appear to also possess a lumen, albeit this is smaller than the lumen of the TRULI treated neuruloids. Is this indicative of slower neurulation compared to controls? Should neurulation be complete at the stages shown? I assume this is the case as the images shown in figure 2D show fully closed lumens.

The phenotype observed in neuruloids is due to both on the relative abundance of discrete lineages (increased epidermis and reduced NC), and on the structural level (failure in closing of the central NE domain). To clarify the point raised by the reviewer we now added a diagram (Figure 6E) to represent the structural aspect of the HD/YAP activation phenotype as well as a paragraph in the Discussion that addresses this point.

8. The authors report that administration of verteporfin in the first three days of culture leads to loss of cell adhesion, but there is not data shown to support this.

We apologize for the confusion. Verteporfin treatment during the first three days of neuruloid differentiation leads to cells death, leading to their detachment from the dish. To better clarify this point we have rephrased that line to be more explicit.

9. The methods section should also include a section on immunoblotting.

We have now included a methods section for immunoblotting and the appropriate reference (Vrbský, et al., 2021)

We would like to thank all three reviewers for taking the time to evaluate our manuscripts and for their suggestions and comments, which we believe will strongly improve the quality of our study.

Article and author information

Author details

  1. Francesco M Piccolo

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Conceptualization, Data curation, Formal analysis, Visualization, Writing – original draft
    Contributed equally with
    Nathaniel R Kastan
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5491-1454
  2. Nathaniel R Kastan

    1. Howard Hughes Medical Institute, The Rockefeller University, New York, United States
    2. Laboratory of Sensory Neuroscience, The Rockefeller University, New York, United States
    Resources, Writing – original draft
    Contributed equally with
    Francesco M Piccolo
    Competing interests
    is part to an application for patent protection of derivatives of the Lats inhibitor TRULI used in this study
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7044-9685
  3. Tomomi Haremaki

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Present address
    RUMI Scientific, New York, United States
    Investigation, Methodology
    Competing interests
    No competing interests declared
  4. Qingyun Tian

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Competing interests
    No competing interests declared
  5. Tiago L Laundos

    1. Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    2. ICBAS - Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto, Porto, Portugal
    3. i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Porto, Portugal
    4. INEB - Instituto de Engenharia Biomédica, Universidade do Porto, Porto, Portugal
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5727-565X
  6. Riccardo De Santis

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Competing interests
    No competing interests declared
  7. Andrew J Beaudoin

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Data curation
    Competing interests
    No competing interests declared
  8. Thomas S Carroll

    Bioinformatics Resource Center, The Rockefeller University, New York, United States
    Data curation
    Competing interests
    No competing interests declared
  9. Ji-Dung Luo

    Bioinformatics Resource Center, The Rockefeller University, New York, United States
    Data curation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0150-1440
  10. Ksenia Gnedeva

    1. Howard Hughes Medical Institute, The Rockefeller University, New York, United States
    2. Laboratory of Sensory Neuroscience, The Rockefeller University, New York, United States
    Present address
    Tina and Rick Caruso Department of Otolaryngology—Head and Neck Surgery, University of Southern California, Los Angeles, United States
    Competing interests
    is part to an application for patent protection of derivatives of the Lats inhibitor TRULI used in this study
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3870-9256
  11. Fred Etoc

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Conceptualization, Methodology, Software
    Competing interests
    is a shareholder of RUMI Scientific
  12. AJ Hudspeth

    1. Howard Hughes Medical Institute, The Rockefeller University, New York, United States
    2. Laboratory of Sensory Neuroscience, The Rockefeller University, New York, United States
    Supervision, Writing – review and editing
    Contributed equally with
    Ali H Brivanlou
    Competing interests
    Is part to to an application for patent protection of derivatives of the Lats inhibitor TRULI used in this study
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0295-1323
  13. Ali H Brivanlou

    Laboratory of of Stem Cell Biology and Molecular Embryology, The Rockefeller University, New York, United States
    Supervision, Writing – review and editing
    Contributed equally with
    AJ Hudspeth
    For correspondence
    Competing interests
    is a co-founder and shareholder of RUMI Scientific
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1761-280X


CHDI Foundation (A-9423)

  • Francesco M Piccolo
  • Tomomi Haremaki
  • Qingyun Tian
  • Tiago L Laundos
  • Andrew J Beaudoin
  • Ali H Brivanlou

National Institute of General Medical Sciences (T32GM007739)

  • Andrew J Beaudoin

European Molecular Biology Organization (EMBO-LTF-254-2019)

  • Riccardo De Santis

National Institute on Deafness and Other Communication Disorders (R21DC016984)

  • Ksenia Gnedeva

Howard Hughes Medical Institute

  • AJ Hudspeth

Fundação para a Ciência e a Tecnologia (PD/BD/127997/2016)

  • Tiago L Laundos

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


FMP, TH, QT, TLL, AJB, and AHB were supported by the CHDI foundation (A-9423). NRK was supported by NIGMS Grant T32GM007739. TLL was also supported by FCT PD/BD/127997/2016. RDS was supported by EMBO-LTF-254-2019. KG was supported by NIDCD Grant R21DC016984. AJH is an Investigator of Howard Hughes Medical Institute.

Senior Editor

  1. Marianne E Bronner, California Institute of Technology, United States

Reviewing Editor

  1. Marianne Bronner, California Institute of Technology, Division of Biology and Biological Engineering, Pasadena, United States


  1. Raman M Das, University of Manchester, United Kingdom

Publication history

  1. Preprint posted: August 11, 2021 (view preprint)
  2. Received: August 15, 2021
  3. Accepted: March 22, 2022
  4. Version of Record published: April 22, 2022 (version 1)


© 2022, Piccolo et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,380
    Page views
  • 183
  • 2

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Francesco M Piccolo
  2. Nathaniel R Kastan
  3. Tomomi Haremaki
  4. Qingyun Tian
  5. Tiago L Laundos
  6. Riccardo De Santis
  7. Andrew J Beaudoin
  8. Thomas S Carroll
  9. Ji-Dung Luo
  10. Ksenia Gnedeva
  11. Fred Etoc
  12. AJ Hudspeth
  13. Ali H Brivanlou
Role of YAP in early ectodermal specification and a Huntington's Disease model of human neurulation
eLife 11:e73075.

Further reading

    1. Cell Biology
    2. Immunology and Inflammation
    Ana J Caetano, Yushi Redhead ... Paul T Sharpe
    Research Article Updated

    The interplay among different cells in a tissue is essential for maintaining homeostasis. Although disease states have been traditionally attributed to individual cell types, increasing evidence and new therapeutic options have demonstrated the primary role of multicellular functions to understand health and disease, opening new avenues to understand pathogenesis and develop new treatment strategies. We recently described the cellular composition and dynamics of the human oral mucosa; however, the spatial arrangement of cells is needed to better understand a morphologically complex tissue. Here, we link single-cell RNA sequencing, spatial transcriptomics, and high-resolution multiplex fluorescence in situ hybridisation to characterise human oral mucosa in health and oral chronic inflammatory disease. We deconvolved expression for resolution enhancement of spatial transcriptomic data and defined highly specialised epithelial and stromal compartments describing location-specific immune programs. Furthermore, we spatially mapped a rare pathogenic fibroblast population localised in a highly immunogenic region, responsible for lymphocyte recruitment through CXCL8 and CXCL10 and with a possible role in pathological angiogenesis through ALOX5AP. Collectively, our study provides a comprehensive reference for the study of oral chronic disease pathogenesis.

    1. Cell Biology
    2. Developmental Biology
    Eunjin Cho, Xiangguo Che ... Tae-Hoon Lee
    Research Article

    Peroxiredoxin 5 (Prdx5) is involved in pathophysiological regulation via the stress-induced cellular response. However, its function in the bone remains largely unknown. Here, we show that Prdx5 is involved in osteoclast and osteoblast differentiation, resulting in osteoporotic phenotypes in Prdx5 knockout (Prdx5Ko) male mice. To investigate the function of Prdx5 in the bone, osteoblasts were analyzed through immunoprecipitation (IP) and liquid chromatography combined with tandem mass spectrometry (LC–MS/MS) methods, while osteoclasts were analyzed through RNA-sequencing. Heterogeneous nuclear ribonucleoprotein K (hnRNPK) was identified as a potential binding partner of Prdx5 during osteoblast differentiation in vitro. Prdx5 acts as a negative regulator of hnRNPK-mediated osteocalcin (Bglap) expression. In addition, transcriptomic analysis revealed that in vitro differentiated osteoclasts from the bone marrow-derived macrophages of Prdx5Ko mice showed enhanced expression of several osteoclast-related genes. These findings indicate that Prdx5 might contribute to the maintenance of bone homeostasis by regulating osteoblast differentiation. This study proposes a new function of Prdx5 in bone remodeling that may be used in developing therapeutic strategies for bone diseases.