1. Immunology and Inflammation
  2. Microbiology and Infectious Disease

A hierarchy of cell death pathways confers layered resistance to shigellosis in mice

  1. Justin L Roncaioli
  2. Janet Peace Babirye
  3. Roberto A Chavez
  4. Fitty L Liu
  5. Elizabeth A Turcotte
  6. Angus Y Lee
  7. Cammie F Lesser
  8. Russell E Vance  Is a corresponding author
  1. Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, United States
  2. Cancer Research Laboratory, University of California, Berkeley, United States
  3. Department of Microbiology, Harvard Medical School, United States
  4. Broad Institute of Harvard and MIT, United States
  5. Department of Medicine, Division of Infectious Diseases, Massachusetts General Hospital, United States
  6. Immunotherapeutics and Vaccine Research Initiative, University of California, Berkeley, United States
  7. Howard Hughes Medical Institute, University of California, Berkeley, United States
https://doi.org/10.7554/eLife.83639
Share this article
Cite this article
  1. Justin L Roncaioli
  2. Janet Peace Babirye
  3. Roberto A Chavez
  4. Fitty L Liu
  5. Elizabeth A Turcotte
  6. Angus Y Lee
  7. Cammie F Lesser
  8. Russell E Vance
(2023)
A hierarchy of cell death pathways confers layered resistance to shigellosis in mice
eLife 12:e83639.
https://doi.org/10.7554/eLife.83639
  2. Download BibTeX
  3. Download .RIS

Abstract

Bacteria of the genus Shigella cause shigellosis, a severe gastrointestinal disease driven by bacterial colonization of colonic intestinal epithelial cells. Vertebrates have evolved programmed cell death pathways that sense invasive enteric pathogens and eliminate their intracellular niche. Previously we reported that genetic removal of one such pathway, the NAIP–NLRC4 inflammasome, is sufficient to convert mice from resistant to susceptible to oral Shigella flexneri challenge (Mitchell et al., 2020). Here, we investigate the protective role of additional cell death pathways during oral mouse Shigella infection. We find that the Caspase-11 inflammasome, which senses Shigella LPS, restricts Shigella colonization of the intestinal epithelium in the absence of NAIP–NLRC4. However, this protection is limited when Shigella expresses OspC3, an effector that antagonizes Caspase-11 activity. TNFα, a cytokine that activates Caspase-8-dependent apoptosis, also provides potent protection from Shigella colonization of the intestinal epithelium when mice lack both NAIP–NLRC4 and Caspase-11. The combined genetic removal of Caspases-1, -11, and -8 renders mice hyper-susceptible to oral Shigella infection. Our findings uncover a layered hierarchy of cell death pathways that limit the ability of an invasive gastrointestinal pathogen to cause disease.

Editor's evaluation

This paper provides important new information on the role of cellular death pathways in mediating resistance and susceptibility of mice to experimental shigellosis. The results rely on experimental observations on the outcome of Shigella in mice gene deficiencies and are convincing. The results will be of interest to immunologists, cell biologists and infectious disease researchers.

https://doi.org/10.7554/eLife.83639.sa0

Introduction

Shigella is a genus of enteric bacterial pathogens that causes ~270 million yearly cases of shigellosis, with ~200,000 of these resulting in death (Khalil et al., 2018). Shigellosis manifests as an acute inflammatory colitis resulting in abdominal cramping, fever, and in severe cases, bloody diarrhea (dysentery) (Kotloff et al., 2018). Bacterial invasion of the colonic intestinal epithelium and subsequent dissemination between adjacent intestinal epithelial cells (IECs) is believed to drive inflammation and disease. Shigella pathogenesis is mediated by a virulence plasmid which encodes a type three secretion system (T3SS) and more than 30 virulence factors or effectors (Schnupf and Sansonetti, 2019; Schroeder and Hilbi, 2008). The T3SS injects effectors into the host cell to facilitate bacterial invasion, escape into the cytosol, and disarmament of the host innate immune response to make the cytosol a hospitable niche for replicating Shigella (Ashida et al., 2015). The virulence plasmid also encodes IcsA, a bacterial surface protein that facilitates cytosolic actin-based motility and is essential for bacterial spread to neighboring IECs (Bernardini et al., 1989; Goldberg and Theriot, 1995; Mattock and Blocker, 2017).

The innate immune system can counteract intracellular bacterial pathogens by inducing programmed cell death (Williams, 1994). Programmed cell death eliminates the intracellular pathogen niche, maintains epithelial barrier integrity, promotes clearance of damaged cells, and enhances presentation of foreign antigens to cells of the adaptive immune system (Deets et al., 2021; Doran et al., 2020; Jorgensen et al., 2017; Koch and Nusrat, 2012; Yatim et al., 2017). Three main modes of programmed cell death are common to mammalian cells: pyroptosis, apoptosis, and necroptosis. Each is controlled by distinct sensors and conserved downstream executors which together provide a formidable barrier that pathogens must avoid or subvert for successful intracellular replication. Of particular relevance to Shigella and other gastrointestinal pathogens, cell death of IECs is accompanied by a unique cellular expulsion process that rapidly and selectively ejects dying or infected cells from the epithelial layer, thereby potently limiting pathogen invasion into deeper tissue (Fattinger et al., 2021; Knodler et al., 2014; Rauch et al., 2017; Sellin et al., 2014).

Shigella is an example of a pathogen in intense conflict with host cell death pathways (Ashida et al., 2021). Shigella encodes multiple effectors to prevent cell death in human cells, including OspC3 to block Caspase-4 inflammasome activation (Kobayashi et al., 2013; Li et al., 2021; Mou et al., 2018; Oh et al., 2021), IpaH7.8 to inhibit Gasdermin D-dependent pyroptosis (Luchetti et al., 2021), OspC1 to suppress Caspase-8-dependent apoptosis (Ashida et al., 2020), and OspD3 to block necroptosis (Ashida et al., 2020). The antagonism of these pathways (and perhaps others that are yet undiscovered) and the resulting maintenance of the epithelial niche appears sufficient to render humans susceptible to Shigella infection. Mice, however, are resistant to oral Shigella challenge because Shigella is unable to counteract epithelial NAIP–NLRC4-dependent cell death and expulsion (Chang et al., 2013; Mitchell et al., 2020). Removal of the NAIP–NLRC4 inflammasome renders mice susceptible to shigellosis, providing a tractable genetic model to dissect Shigella pathogenesis after oral infection in vivo (Mitchell et al., 2020).

Here, we use the NAIP–NLRC4-deficient mouse model of shigellosis to investigate the role of programmed cell death in defense against Shigella in vivo. We find that Caspase-11 (CASP11), a cytosolic sensor of LPS and the mouse ortholog of human Caspase-4 (Shi et al., 2014), provides modest protection from Shigella infection in the absence of NAIP–NLRC4. As in humans, this pathway is antagonized by the Shigella effector OspC3, and genetic removal of ospC3 from Shigella results in a significant CASP11-dependent reduction in bacterial colonization of IECs and virulence. We also find that TNFα, a cytokine that can induce TNF receptor 1 (TNFRI)-dependent extrinsic apoptosis (Piguet et al., 1998), defends mouse IECs from bacterial colonization and limits subsequent disease. TNFα-dependent protection is strongest when mice lack both NAIP–NLRC4 and CASP11, revealing a hierarchical program of cell death pathways that counteract Shigella in vivo. Casp1/11–/–Ripk3–/– and Casp8–/–Ripk3–/– mice, which lack some but not all key components of pyroptosis, apoptosis, and necroptosis, are largely protected from disease, revealing redundancies among these pathways. Casp1/11/8–/–Ripk3–/– mice, however, are hyper-susceptible to shigellosis, indicating that programmed cell death is a predominant host defense mechanism against Shigella infection. Furthermore, neither interleukin-1 receptor (IL-1R)-mediated signaling nor myeloid-restricted NAIP–NLRC4 have an apparent effect on Shigella pathogenesis, suggesting that it is cell death of IECs that primarily protects mice from shigellosis. Our findings underscore the importance of cell death in defense against intracellular bacterial pathogens and provide an example of how layered and hierarchical immune pathways can provide robust defense against pathogens that have evolved a broad arsenal of virulence factors.

Results

CASP11 contributes to resistance of B6 versus 129 Nlrc4–/– mice to shigellosis

We previously generated NLRC4-deficient mice on the 129S1/SvImJ (129) background (129.Nlrc4–/–) and observed that these mice appeared more susceptible to oral Shigella flexneri challenge than C57BL/6J (B6) NLRC4-deficient mice (B6.Nlrc4–/–) (Mitchell et al., 2020). We reasoned that the apparent difference between the strains might be due to genetic and/or microbiota differences. To address these possibilities, we infected co-housed B6.Nlrc4–/– and 129.Nlrc4–/– mice and directly compared disease severity between the two strains (Figure 1, light blue versus pink symbols). The B6.Nlrc4–/– mice exhibited only modest weight loss (5–10% of starting weight) through two days and began to recover by day 3 (Figure 1A). The 129.Nlrc4–/– mice, however, continued to lose weight through day 3 (10–15% of starting weight) (Figure 1A). Upon sacrifice at day 3, we harvested the IEC fraction from the cecum and colon of each mouse, washed this fraction in gentamicin to eliminate any extracellular Shigella, and lysed these cells to enumerate intracellular bacterial colonization of IECs. IECs from 129.Nlrc4–/– mice harbored >10-fold higher intracellular Shigella burdens than those from B6.Nlrc4–/– mice (Figure 1B). We also found that 129.Nlrc4–/– mice had higher levels of inflammatory cytokines CXCL1 and IL-1β in their intestinal tissue, as measured by ELISA (Figure 1C and D). CXCL1 and IL-1β are NF-κB-induced cytokines previously implicated in driving disease during shigellosis by initiating inflammation and promoting innate immune cell recruitment to the gut (Arondel et al., 1999; Sansonetti et al., 1999; Sansonetti et al., 2000; Singer and Sansonetti, 2004). Here, these cytokines serve as biomarkers of disease. Because the ELISA used cannot distinguish between pro-IL-1β and cleaved IL-1β, reported IL-1β levels reflect the strength of the NF-κB response (as do reported CXCL1 levels) rather than the strength of Caspase-1 activation. The 129.Nlrc4–/– mice also exhibited significantly more gross cecum shrinkage than B6.Nlrc4–/– mice (Figure 1E) and there were modest but insignificant increases in diarrhea (as measured by the wet weight to dry weight ratio of mouse feces) in 129.Nlrc4–/– mice relative to the B6.Nlrc4–/– mice at 2 and 3 days post-infection (Figure 1F). We scored mouse feces for the presence of occult blood (score = 1) or macroscopic blood (score = 2) at days 2 and 3, the sum of which represents a blood score from 0 to 4 (Figure 1G). All 129.Nlrc4–/– mice had occult blood in their feces on at least one of these days, with many having occult or macroscopic blood on both days. In contrast, B6.Nlrc4–/– mice did not exhibit fecal blood.

Figure 1 with 2 supplements see all
Download asset Open asset
CASP11 contributes to resistance of B6 versus 129 Nlrc4–/– mice to shigellosis.

(A–G) B6.Nlrc4–/– mice (pink, n=6), 129.Nlrc4–/– mice (light blue, n=6), and backcrossed littermates that are homozygous 129/129 at Casp11 (dark blue, n=9) or heterozygous B6/129 at Casp11 (maroon, n=7) were co-housed for 3 weeks, treated orally with 25 mg streptomycin sulfate in water, and orally challenged the next day with 107 colony forming units (CFUs) of wild-type (WT) Shigella flexneri. Mice were sacrificed at 3 days post-infection. (A) Mouse weights from 0 through 3 days post-infection. Each symbol represents the mean for all mice of the indicated genotype. (B) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (C, D) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (E) Quantification of cecum lengths normalized to mouse weight prior to infection; cecum length (cm)/mouse weight (g). (F) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. A larger wet/dry ratio indicates increased diarrhea. Pellets were collected daily from 0 to 3 days post-infection. (G) Additive blood scores from feces collected at 2 and 3 days post-infection. 1=occult blood, 2=macroscopic blood for a given day, maximum score is 4. (B–G) Each symbol represents one mouse. Data collected from one experiment. Mean ± SD is shown in (A, C– E). Geometric mean ± SD is shown in (B). Mean ± SEM is shown in (F). Statistical significance was calculated by one-way ANOVA with Tukey’s multiple comparison test (A (day 3), B, C, D, E, and G) and by two-way ANOVA with Tukey’s multiple comparison test (F). Data were log-transformed prior to calculations in (B) and (F) to achieve normality. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

The significant difference in disease severity between co-housed 129 and B6 Nlrc4–/– mice suggested that genetic rather than microbiota differences might explain the differential susceptibility of the strains. The mouse non-canonical inflammasome Caspase-11 and its human orthologs Caspases-4 and -5 sense cytosolic Shigella LPS to initiate pyroptosis (Hagar et al., 2013; Kayagaki et al., 2011; Kobayashi et al., 2013; Shi et al., 2014). Notably, 129 mice are naturally deficient for Caspase-11 (Kayagaki et al., 2011). To determine if Caspase-11 contributes to the difference in susceptibility between these strains, we crossed B6.Nlrc4–/– and 129.Nlrc4–/– mice to generate B6/129.Nlrc4–/– F1 hybrids (Figure 1—figure supplement 1A). We infected these F1 B6/129. Nlrc4–/– hybrids and found that they were relatively resistant to Shigella challenge and their disease profile more consistently resembled that of the parental B6.Nlrc4–/– mice (Figure 1—figure supplement 1B–F). These results are consistent with the possibility that a dominant gene on the C57BL/6J background provides protection from Shigella. Next, we backcrossed these hybrids to the 129.Nlrc4–/– parental strain to generate littermate Nlrc4–/– mice that were homozygous 129/129 or heterozygous B6/129 at Casp11 (Figure 1—figure supplement 1A). These Nlrc4–/– backcrossed mice were co-housed with their parental 129.Nlrc4–/– and B6.Nlrc4–/– strains for >3 weeks, infected with Shigella, and genotyped at the Casp11 locus to determine whether a functional B6 Casp11 allele would correlate with reduced disease severity.

Indeed, backcrossed Nlrc4–/– mice that were heterozygous B6/129 at Casp11 (Figure 1, maroon symbols) were more resistant to shigellosis than backcrossed Nlrc4–/– mice that were 129/129 at Casp11 (Figure 1, dark blue symbols). Mice that were heterozygous B6/129 at Casp11 showed a similar weight loss pattern to the parental B6.Nlrc4–/– mice and began to recover by day 3 while the weight loss in mice that were homozygous 129/129 at Casp11 phenocopied that of the parental 129.Nlrc4–/– mice (Figure 1A). Consistent with these results, mice that were homozygous 129/129 at Casp11 also exhibited significantly enhanced bacterial colonization of the intestinal epithelium (Figure 1B). We observed trending but insignificant increases in inflammatory cytokine CXCL1 (Figure 1C) and cecum shrinkage (Figure 1E) and significantly more pronounced diarrhea at day 2 (Figure 1F) in mice that were 129/129 at Casp11 relative to mice that were B6/129 at Casp11. Despite these differences, there was no strong correlation between IL-1β levels (Figure 1D) or fecal blood score (Figure 1G) and Casp11 genotype, suggesting that while Casp11 contributes to resistance, there are additional genetic modifiers present on the 129 or B6 background that affect susceptibility to shigellosis. As these additional modifiers appear to be relatively weak compared to Casp11, we did not attempt to map them genetically. However, we did specifically test for a contribution of Hiccs, a genetic locus in 129 mice that associates with increased susceptibility to Helicobacter hepaticus-dependent colitis (Boulard et al., 2012). To do so, we genotyped the same Nlrc4–/– backcrossed mice at the Hiccs locus and used the same data from Figure 1 to determine whether a 129 or B6 Hiccs allele associated with differences in disease (Figure 1—figure supplement 1A). In contrast to Casp11, we found that Hiccs did not significantly correlate with increased susceptibility to shigellosis (Figure 1—figure supplement 2).

CASP11 modestly contributes to resistance of B6.Nlrc4–/– mice to shigellosis

To define the role of mouse Caspase-11 in a uniform genetic background, we generated Casp11–/– mice on the B6.Nlrc4–/– background using CRISPR-Cas9 editing (Figure 2—figure supplement 1). We previously found that Casp1/11–/– mice are resistant to oral wild-type (WT) S. flexneri infection, likely because NLRC4-dependent Caspase-8 activation is sufficient to prevent bacterial colonization of IECs (Figure 2—figure supplement 2; Mitchell et al., 2020; Rauch et al., 2017). Thus, Caspase-11 is dispensable for protection from WT Shigella challenge when mice express functional NLRC4, but Caspase-11 could still be critical as a backup pathway in the absence of NLRC4. We therefore challenged B6.Nlrc4–/–Casp11+/– and B6.Nlrc4–/–Casp11–/– littermates with WT Shigella and assessed pathogenicity for 2 days following infection.

We observed a modest increase in susceptibility to Shigella infection in B6.Nlrc4–/–Casp11–/– mice relative to B6.Nlrc4–/–Casp11+/– (Figure 2). While B6.Nlrc4–/–Casp11–/– mice did not experience more weight loss (Figure 2A), cecum shrinkage (Figure 2B), or diarrhea (Figure 2C) than B6.Nlrc4–/–Casp11+/–, there was a fivefold increase in Shigella burdens in IECs from B6.Nlrc4–/–Casp11–/– mice (Figure 2D), indicating that Caspase-11 protects the mouse epithelium from bacterial colonization in the absence of NLRC4. Intestinal tissue from B6.Nlrc4–/–Casp11–/– mice also expressed significantly higher levels of CXCL1 than tissue from B6.Nlrc4–/–Casp11+/– (Figure 2E). IL-1β levels appeared elevated in B6.Nlrc4–/–Casp11–/– mice relative to B6.Nlrc4–/–Casp11+/–, however this difference was not significant (Figure 2F). B6.Nlrc4–/–Casp11+/– did not exhibit blood in their feces but two of the nine B6.Nlrc4–/–Casp11–/– did present with occult blood (Figure 2G) – an increase that is not statistically significant. These results suggest that Caspase-11 has a relatively modest contribution to defense against WT Shigella. Indeed, a minor role for Caspase-11 is expected given that Shigella is known to encode an effector called OspC3 that inhibits Caspase-11 (see below). Nevertheless, taken together, our results in mixed 129/B6.Nlrc4–/– and B6.Nlrc4–/–Casp11–/– mice indicate that Caspase-11 contributes to defense against Shigella in vivo as a backup pathway in the absence of NLRC4 (Figure 2—figure supplement 2).

Figure 2 with 2 supplements see all
Download asset Open asset
CASP11 modestly contributes to resistance of B6.Nlrc4–/– mice to shigellosis.

(A–G) B6.WT mice (co-housed B6.WT and B6.Nlrc4+/–Casp11+/–mice, black, n=5) and B6.Nlrc4–/–Casp11+/– (teal, n=10) and B6.Nlrc4–/–Casp11–/– (lavender, n=9) littermates were treated orally with 25 mg streptomycin sulfate in water and orally challenged the next day with 107 colony forming units (CFUs) of wild-type (WT) Shigella flexneri. Mice were sacrificed at 2 days post-infection. (A) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated genotype. (B) Quantification of cecum lengths normalized to mouse weight prior to infection; cecum length (cm)/mouse weight (g). (C) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. Pellets were collected at day 2 post-infection. A larger wet/dry ratio indicates increased diarrhea. (D) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (E, F) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (G) Blood scores from feces collected at 2 days post-infection. 1=occult blood, 2=macroscopic blood. (B–G) Each symbol represents one mouse. Data collected from two independent experiments. Mean ± SD is shown in (A–C, E, F). Geometric mean ± SD is shown in (D). Statistical significance was calculated by Mann-Whitney test in (A–F) and by Fisher’s exact test in (G) where data were stratified by presence (score = 1 or 2) or absence (score = 0) of blood. In (A) statistical analysis was performed at day 2. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

Shigella effector OspC3 is critical for virulence in oral Shigella infection

S. flexneri protein OspC3 is a T3SS-secreted effector that inhibits both human Caspase-4 and mouse Caspase-11 to suppress pyroptosis (Kobayashi et al., 2013; Li et al., 2021; Mou et al., 2018; Oh et al., 2021). While OspC3 has been shown to be required for virulence during intraperitoneal mouse infection by S. flexneri (Li et al., 2021; Oh et al., 2021) and for intestinal colonization by S. sonnei in WT mice (Alphonse et al., 2022), the role of this effector has not been studied in an oral mouse model of infection where Shigella invades and replicates within the intestinal epithelium. Indeed, our results indicating a role for Caspase-11 in defense against WT Shigella (see above, Figures 1 and 2) suggested that the inhibition of Caspase-11 by OspC3 could be incomplete in epithelial cells. To test the role of OspC3 in shigellosis, we orally infected B6.Nlrc4–/– mice (a mixture of Caspase-11 sufficient co-housed B6.Nlrc4–/–Casp11+/+ mice and B6.Nlrc4–/–Casp11+/– mice) with WT S. flexneri or a mutant stain that lacks OspC3 (ΔospC3) (Figure 3). Consistent with our previous experiments, B6.Nlrc4–/– mice challenged with WT Shigella developed shigellosis characterized by significant weight loss, increases in bacterial colonization of the intestinal epithelium, cecum shrinkage, diarrhea, and inflammatory cytokines (Figure 3A–G) relative to WT mice infected with WT Shigella. However, B6.Nlrc4–/– mice challenged with ΔospC3 S. flexneri were less susceptible to infection (Figure 3), exhibiting significantly less weight loss (Figure 3B), a >10-fold decrease in IEC colonization (Figure 3C), reduced cecum shrinkage (Figure 3D), and a decrease in CXCL1 (Figure 3F) relative to WT-infected B6.Nlrc4–/– mice. We did not observe significant differences in diarrhea (Figure 3E) and IL-1β (Figure 3G) between these two groups. Interestingly, ΔospC3-infected B6.Nlrc4–/– mice did experience trending but insignificant increases in weight loss (Figure 3B), bacterial colonization of IECs (Figure 3C), cecum shrinkage (Figure 3A and D), and inflammatory cytokines (Figure 3F and G) relative to WT mice infected with WT Shigella. B6.Nlrc4–/– mice infected with ΔospC3 S. flexneri did not display fecal blood while six of the eleven B6.Nlrc4–/– mice infected with WT Shigella did present with fecal blood (Figure 3H). These results indicate that ΔospC3 Shigella is significantly attenuated in our B6.Nlrc4–/– mouse model of shigellosis.

Figure 3
Download asset Open asset
Shigella effector OspC3 is critical for virulence in oral Shigella infection.

(A–H) Mice were treated orally with 25 mg streptomycin sulfate in water and infected 1 day later. B6.WT mice (co-housed wild-type [WT] and B6.Nlrc4+/–Casp11+/–) were orally challenged with 107 colony forming units (CFUs) of WT Shigella flexneri (n=7) and B6.Nlrc4–/– mice (co-housed B6.Nlrc4–/– and B6.Nlrc4–/–Casp11+/–) were challenged with WT (green, n=11) or ΔospC3 S. flexneri (blue, n=11). Mice were sacrificed at 2 days post-infection. (A) Representative images of the cecum and colon from B6.Nlrc4–/– mice infected with WT or ΔospC3 S. flexneri. The white arrow indicates clear but reduced inflammation in mice infected with the ΔospC3 strain. (B) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated genotype. (C) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (D) Quantification of cecum lengths normalized to mouse weight prior to infection; cecum length (cm)/mouse weight (g). (E) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. Pellets were collected at day 2 post-infection. (F, G) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (H) Blood scores from feces collected at 2 days post-infection. 1=occult blood, 2=macroscopic blood. (C–H) Each symbol represents one mouse. Data collected from two independent experiments. Mean ± SD is shown in (B, D–G). Geometric mean ± SD is shown in (C). Statistical significance was calculated by one-way ANOVA with Tukey’s multiple comparison test (B (day 2), C–G) and by Fisher’s exact test in (H) where data were stratified by presence (score = 1 or 2) or absence (score = 0) of blood. Data were log-transformed prior to calculations in (C) to achieve normality. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

OspC3 directly inactivates mouse Caspase-11 (Li et al., 2021) but has also been reported to modulate other signaling pathways, including interferon signaling (Alphonse et al., 2022). To test if the effect of OspC3 on virulence is dependent on inhibition of mouse Caspase-11, we infected both B6.Nlrc4–/– mice (that were a mixture of co-housed B6.Nlrc4–/–Casp11+/– and B6.Nlrc4–/–Casp11+/+ mice) and B6.Nlrc4–/–Casp11–/– mice (littermates with B6.Nlrc4–/–Casp11+/–) with either WT or ΔospC3 Shigella strains. We again observed that the ospC3 mutant was attenuated relative to WT Shigella in B6.Nlrc4–/– mice (Figure 4). However, both WT and ΔospC3 Shigella caused severe disease in B6.Nlrc4–/–Casp11–/– mice, with comparable weight loss, bacterial colonization of the intestinal epithelium, cecum lengths, diarrhea, and fecal blood (Figure 4A–D and G). ΔospC3-infected B6.Nlrc4–/– mice exhibited significantly less weight loss, bacterial burdens, cecum shrinkage, and IL-1β relative to ΔospC3-infected B6.Nlrc4–/–Casp11–/– mice (Figure 4A, B, C and F). These results indicate that Caspase-11 is the primary physiological target of OspC3 in vivo. Caspase-11 provides potent defense against Shigella in the absence of OspC3, although this does not appear sufficient to fully compensate for the loss of NLRC4, as ΔospC3-infected B6.Nlrc4–/– mice exhibit a phenotype that trends toward modest susceptibility relative to WT-infected WT control mice (Figure 3, Figure 4). We did observe a trending but insignificant decrease in CXCL1 and a significant decrease in IL-1β in ΔospC3-infected B6.Nlrc4–/–Casp11–/– mice relative to WT-infected B6.Nlrc4–/–Casp11–/– mice (Figure 4E and F), indicating that OspC3 might also affect immune pathways independent of Caspase-11. Again, we only observed modest differences in disease hallmarks between B6.Nlrc4–/– and B6.Nlrc4–/–Casp11–/– mice infected with WT Shigella (Figure 4), none of which were significant, consistent with the ability of OspC3 to significantly reduce Caspase-11 activity. These results confirm prior reports that OspC3 inhibits Caspase-11 in vivo (Kobayashi et al., 2013; Li et al., 2021; Mou et al., 2018; Oh et al., 2021) and further show that OspC3-dependent inhibition of Caspase-11 is required for Shigella virulence. Nonetheless, this inhibition is likely incomplete, as Caspase-11 still provides a small degree of protection in B6.Nlrc4–/– mice even when Shigella expresses OspC3 (Figures 2 and 4).

Figure 4
Download asset Open asset
OspC3-driven virulence in B6.Nlrc4–/– mice depends on Caspase-11.

(A–G) Mice were treated orally with 25 mg streptomycin sulfate in water and then infected 1 day later. B6.WT mice were orally challenged with 107 colony forming units (CFUs) of wild-type (WT) Shigella flexneri (black, n=8), B6.Nlrc4–/– (co-housed B6.Nlrc4–/–Casp11+/+ and B6.Nlrc4–/–Casp11+/–) mice were challenged with WT (blue, n=10) or ΔospC3 S. flexneri (pink, n=9), and B6.Nlrc4–/–Casp11–/– mice (littermates with the B6.Nlrc4–/–Casp11+/–) were challenged with WT (teal, n=13) or ΔospC3 S. flexneri (maroon, n=15). Mice were littermates or were co-housed for 3 weeks prior to infection and were sacrificed at 2 days post-infection. (A) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated group. (B) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (C) Quantification of cecum lengths normalized to mouse weight prior to infection; cecum length (cm)/mouse weight (g). (D) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. Pellets were collected at day 2 post-infection. (E, F) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (G) Blood scores from feces collected at 2 days post-infection. 1=occult blood, 2=macroscopic blood. (B–G) Each symbol represents one mouse. Data collected from two independent experiments. Mean ± SD is shown in (A, C–F). Geometric mean ± SD is shown in (B). Statistical significance was calculated by one-way ANOVA with Tukey’s multiple comparison test (A (day 2), B–F) and by Fisher’s exact test in (G) where data were stratified by presence (score = 1 or 2) or absence (score = 0) of blood. Data were log-transformed prior to calculations in (B, D) to achieve normality. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

Neither myeloid NLRC4 nor IL-1 affects Shigella pathogenesis

The generally accepted model of Shigella pathogenesis proposes that Shigella bacteria cross the colonic epithelium via transcytosis through M-cells (Schnupf and Sansonetti, 2019; Schroeder and Hilbi, 2008). After transcytosis, Shigella is then believed to be phagocytosed by macrophages, followed by two additional steps: (1) the inflammasome-dependent lysis of infected macrophages to release bacteria to facilitate epithelial invasion (Schnupf and Sansonetti, 2019; Suzuki et al., 2007; Zychlinsky et al., 1994; Zychlinsky et al., 1996), and (2) the concomitant processing and release of IL-1β, a pro-inflammatory cytokine, that drives inflammation (Arondel et al., 1999; Sansonetti et al., 1995; Sansonetti et al., 2000). However, the roles of these particular steps during mammalian oral infection have never been addressed with genetic loss-of-function experiments.

To evaluate the role of NLRC4 inflammasome activation in myeloid cells, we utilized Nlrc4–/–Rosa26LSL-Nlrc4Lyz2Cre mice (here referred to simply as iNlrc4Lyz2Cre mice) (Rauch et al., 2017). These mice harbor a germline null mutation in Nlrc4, but encode a Lyz2Cre-inducible Nlrc4 cDNA transgene (integrated within the Rosa26 locus) that restores NLRC4 expression selectively in myeloid cells (primarily macrophages, monocytes, and neutrophils). We infected WT B6 mice and B6.iNlrc4+Lyz2Cre+ and B6.Nlrc4–/– (iNlrc4–Lyz2Cre+) littermates and compared disease outcomes across genotypes (Figure 5). Surprisingly, iNlrc4+Lyz2Cre+ mice phenocopied B6.Nlrc4–/– mice, and did not exhibit significant differences in weight loss, bacterial colonization of the intestinal epithelium, cecum length, or diarrhea (Figure 5A–E). There was a modest but insignificant increase in inflammatory cytokines CXCL1 and IL-1β in B6.Nlrc4–/– mice (Figure 5F and G), but fewer of these mice displayed fecal blood compared to iNlrc4+Lyz2Cre+ mice (Figure 5H). These results provide a striking contrast to our previous results with iNlrc4+VilCreCre+ mice in which NLRC4 is selectively expressed in IECs (Mitchell et al., 2020). Unlike iNlrc4+Lyz2Cre+ mice, iNlrc4+VilCreCre+ mice were strongly protected from oral Shigella infection, implying that epithelial but not myeloid cell NLRC4 is protective. We conclude that NLRC4-dependent pyroptosis in macrophages is neither a major driver of disease pathogenesis nor bacterial colonization in our oral mouse model of infection.

Figure 5
Download asset Open asset
NLRC4 in myeloid-derived cells does not affect Shigella pathogenesis.

(A–H) B6.WT (black, n=10) mice were co-housed with B6.iNlrc4+Lyz2Cre+ (blue, n=18) and B6.Nlrc4–/– (iNlrc4–Lyz2Cre+, red, n=15) littermates, treated orally with 25 mg streptomycin sulfate in water, and orally challenged the next day with 107 colony forming units (CFUs) of wild-type (WT) Shigella flexneri. Mice were sacrificed at 2 days post-infection. (A) Representative images of the cecum and colon from iNlrc4+Lyz2Cre+ and B6.Nlrc4–/– mice. Note the similarity in gross pathology between the two genotypes. (B) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated group. (C) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (D) Quantification of cecum lengths normalized to mouse weight prior to infection; cecum length (cm)/mouse weight (g). (E) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. Pellets were collected at day 2 post-infection. (F, G) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (H) Blood scores from feces collected at 2 days post-infection. 1=occult blood, 2=macroscopic blood. (C–H) Each symbol represents one mouse. Data collected from two independent experiments. Mean ± SD is shown in (B, D–G). Geometric mean ± SD is shown in (C). Statistical significance was calculated by one-way ANOVA with Tukey’s multiple comparison test (B (day 2), C–G) and by Fisher’s exact test in (H) where data were stratified by presence (score = 1 or 2) or absence (score = 0) of blood. Data were log-transformed prior to calculations in (C) to achieve normality. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

IL-1α and IL-1β are related cytokines that are produced downstream of inflammasome activation in myeloid cells and that signal via the common IL-1 receptor. IL-1 cytokines have been implicated in driving inflammation in the context of mouse intranasal Shigella challenge (Sansonetti et al., 2000) and rabbit ligated intestinal loop infection (Sansonetti et al., 1995). To better address the role of IL-1 in shigellosis, we crossed B6.Nlrc4–/– mice to B6.Il1r1–/– mice to generate B6.Nlrc4–/–Il1r1–/– double-deficient mice that are susceptible to Shigella infection but fail to respond to IL-1. We infected Nlrc4+Il1r1+mice (co-housed B6.WT and Nlrc4+/–Il1r1+/–mice), Nlrc4+/–Il1r1–/–, Nlrc4–/–Il1r1+/–, and Nlrc4–/–Il1r1–/– littermates and again assessed disease outcomes (Figure 6). Surprisingly, Nlrc4–/–Il1r1–/– mice largely phenocopied Nlrc4–/–Il1r1+/– mice. Nlrc4–/–Il1r1–/– appeared less susceptible to weight loss than Nlrc4–/–Il1r1+/–mice, although this difference was not statistically significant. Furthermore, we did not observe differences in colonization of the intestinal epithelium, normalized cecum lengths, or inflammatory cytokines (Figure 6A–E) between Nlrc4–/–Il1r1–/– and Nlrc4–/–Il1r1+/– mice. In many bacterial infections, IL-1 signaling initiates the recruitment of neutrophils to sites of infection. We did not observe a significant difference in the amount of the neutrophil marker myeloperoxidase (MPO) in the feces of Nlrc4–/–Il1r1–/– versus Nlrc4–/– Il1r1+/– mice at 1 day post-infection, however, there was a modest but significant decrease in fecal MPO in Nlrc4–/–Il1r1–/– relative to Nlrc4–/– Il1r1+/– mice at 2 days post-infection, suggesting that IL-1 might be essential for sustained neutrophilic inflammation during Shigella infection (Figure 6F). We also found that Nlrc4+/–Il1r1–/– mice largely phenocopy Nlrc4+/–Il1r1+/– mice and are resistant to infection. Overall, these results indicate that, despite the increases in IL-1β consistently seen in susceptible mice, IL-1 signaling might affect neutrophil recruitment but is not a primary driver of pathogenesis or protection during oral Shigella infection. NLRC4-dependent resistance to shigellosis is therefore likely due to the initiation of pyroptosis and expulsion in IECs and not myeloid cell pyroptosis nor IL-1 signaling. Our results leave open a possible role for another inflammasome-dependent cytokine, IL-18, which unlike IL-1β, is highly expressed in IECs.

Figure 6
Download asset Open asset
IL-1 signaling does not affect Shigella pathogenesis.

(A–F) Nlrc4+Il1r1+mice (co-housed B6.WT and Nlrc4+/–Il1r1+/–, black, n=7), Nlrc4+/–Il1r1–/– (blue, n=7), Nlrc4–/–Il1r1+/– (teal, n=7), and Nlrc4–/–Il1r1–/– (maroon, n=7) littermates were treated orally with 25 mg streptomycin sulfate in water and orally challenged the next day with 107 colony forming units (CFUs) of wild-type (WT) Shigella flexneri. Mice were sacrificed at 2 days post-infection. (A) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated group. (B) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (C) Quantification of cecum lengths normalized to mouse weight prior to infection; cecum length (cm)/mouse weight (g). (D, E) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (F) Myeloperoxidase enzyme levels in mouse feces collected each day prior to and during infection and measured by ELISA. (B–F) Each symbol represents one mouse. Data were collected from one experiment but are representative of two independent experiments. Mean ± SD is shown in (A, C–F). Geometric mean ± SD is shown in (B). Statistical significance was calculated by one-way ANOVA with Tukey’s multiple comparison test (A (day 2), B–E) and two-way ANOVA with Tukey’s multiple comparison test (F). Data were log-transformed prior to calculations in (B) to achieve normality. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

TNFα contributes to resistance to Shigella

Given that both NLRC4 and CASP11 protect the mouse epithelium from Shigella colonization, we reasoned that additional mechanisms of cell death might function in this niche to counteract Shigella invasion and spread. Another cell death initiator in the intestine is TNFα, which has been shown to promote Salmonella-induced IEC death and dislodgement (Fattinger et al., 2021). TNFα initiates Caspase-8-dependent apoptosis through TNFRI engagement particularly when NF-κB signaling is altered or blocked (Leppkes et al., 2014; Liu et al., 2004; Piguet et al., 1998; Ruder et al., 2019). Shigella encodes several effectors reported to inhibit NF-κB signaling (Ashida et al., 2010; Ashida et al., 2013; de Jong et al., 2016; Kim et al., 2005; Newton et al., 2010; Sanada et al., 2012; Wang et al., 2013), and thus, we hypothesized that TNFα might restrict Shigella by inducing death of infected IECs.

To assess the in vivo role of TNFα during shigellosis, we first infected B6.Nlrc4–/– mice treated with an antibody that neutralizes TNFα, or with an isotype control antibody (Figure 7). B6.Nlrc4–/– mice that underwent TNFα neutralization appeared slightly more susceptible to shigellosis than B6.Nlrc4–/– mice treated with control antibody and displayed trending but insignificant increases in weight loss, bacterial burdens in IECs, IL-1β levels, and fecal blood (Figure 7A, B, D and E) and a significant increase in CXCL1 (Figure 7C). B6.Nlrc4–/– mice express a functional Caspase-11 inflammasome and given the redundancy we observed between NLRC4 and Caspase-11 (Figures 1—4, Mitchell et al., 2020), we hypothesized that a protective role for TNFα during Shigella infection might be most evident in the absence of both of these cell death pathways. To test this, we repeated the experiment in B6.Nlrc4–/–Casp11–/– mice and, indeed, found that TNFα neutralization on this genetic background significantly increased susceptibility to Shigella infection. Mice treated with antibody to TNFα experienced an ~5% increase in weight loss, a 10-fold increase in bacterial colonization of the intestinal epithelium, and significant increases in colonic shrinkage, diarrhea, and inflammatory cytokines (Figure 7F–H and J–N). There was also a trending but insignificant increase in occult and macroscopic blood in the mice treated with TNFα neutralizing antibody. TNFα levels were elevated significantly in B6.Nlrc4–/–Casp11–/– mice, indicating that expression of this cytokine is induced in susceptible mice (Figure 7N). The anti-TNFα antibody did not decrease the levels of TNFα measured by ELISA because the antibody neutralizes signaling by the cytokine without interfering with its ability to be detected by ELISA.

Figure 7 with 1 supplement see all
Download asset Open asset
TNFα contributes to resistance to Shigella when mice lack NLRC4 and CASP11.

Wild-type (WT) (B6.WT, black, n=13 for (A–E), and both co-housed B6.WT and B6.Nlrc4+/–Casp11+/–, black, n=9 for (F–O)), B6.Nlrc4–/–, and B6.Nlrc4–/–Casp11–/– mice were treated orally with 25 mg streptomycin sulfate in water and orally challenged the next day with 107 colony forming units (CFUs) of WT Shigella flexneri. In (A–E), B6.Nlrc4–/– mice received 200 μg of either TNFα neutralizing antibody (pink, n=13) or isotype control antibody (light blue, n=14) by intraperitoneal injection daily from 1 day before infection through sacrifice at 2 days post-infection. In (F–O), B6.Nlrc4–/–Casp11–/– mice received 200 μg of either TNFα neutralizing antibody (teal, n=12) or isotype control antibody (maroon, n=13) by intraperitoneal injection daily from 1 day before infection through sacrifice at 2 days post-infection. (A, G) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated group. (B, H) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (C, D, L–N) CXCL1, IL-1β, and TNFα levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (E, O) Blood scores from feces collected at 2 days post-infection. 1=occult blood, 2=macroscopic blood. (F) Representative images of the cecum and colon from B6.Nlrc4–/–Casp11–/– mice receiving either isotype control or TNFα neutralizing antibody. (I, J) Quantification of cecum and colon lengths normalized to mouse weight prior to infection; cecum or colon length (cm)/mouse weight (g). (K) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. Pellets were collected at day 2 post-infection. (B–E, H–O) Each symbol represents one mouse. Data collected from three independent experiments (A–E) and two independent experiments (F–O). Mean ± SD is shown in (A, C, D, G, I–N). Geometric mean ± SD is shown in (B, H). Statistical significance was calculated by Mann-Whitney test in (A (day 2), B–D, G (day 2), H–M), by one-way ANOVA with Tukey’s multiple comparison test in (N), and by Fisher’s exact test in (E, O) where data were stratified by presence (score = 1 or 2) or absence (score = 0) of blood. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

Importantly, we could also observe a strong protective role for TNFα in similar experiments performed in 129.Nlrc4–/– mice that are naturally deficient in Caspase-11 (Figure 7—figure supplement 1), confirming that TNFα-dependent protection is redundant with both NLRC4 and Caspase-11. These results suggest that a hierarchy of cell death pathways protect the intestinal epithelium from Shigella infection. NLRC4 appears to be both necessary and sufficient to protect mice from shigellosis, but in the absence of NLRC4, both Caspase-11 (even in the presence of Shigella effector OspC3) and TNFα can provide modest secondary protection (Figures 1, 2 and 7A–E). These dual Caspase-11 and TNFα backup pathways appear to have overlapping and compensatory functions during Shigella infection, as it is only the removal of both pathways in NLRC4-deficient mice that drives a striking increase in susceptibility to Shigella infection. However, since Caspase-11 can significantly but not completely compensate for loss of NLRC4 when Shigella lacks OspC3 (Figure 3 and Figure 4) but TNFα appears unable to compensate for loss of NLRC4 (Figure 7A–E), Caspase-11 appears to supersede TNFα in the defense hierarchy.

Loss of multiple cell death pathways renders mice hyper-susceptible to Shigella

To test the role of Caspase-8 during Shigella infection, we generated mice lacking either Caspases-1 and -11 (B6.Casp1/11–/–Casp8+/–Ripk3–/–), Caspase-8 (B6.Casp1/11+/–Casp8–/–Ripk3–/–), or Caspases-1, -11, and -8 (B6.Casp1/11/8–/–Ripk3–/–). Since loss of Caspase-8 results in Ripk3-depedent embryonic lethality, all three genotypes lack Ripk3. Casp1/11–/–Casp8+/–Ripk3–/– mice retain Caspase-8 function downstream of both NLRC4 and TNFα (Figure 2—figure supplement 2) and based on our previous experiments with Casp1/11–/– mice (Mitchell et al., 2020), we expected that these mice would be resistant to infection. Similarly, Casp1/11+/–Casp8–/–Ripk3–/– mice retain the ability to recruit Caspase-1 to NLRC4 and to initiate cell death via Caspase-11 (Figure 2—figure supplement 2) and should also thus be resistant to infection. Casp1/11/8–/–Ripk3–/– mice, however, should lack the cell death pathways initiated by NLRC4 (via Caspase-1 or Caspase-8), Caspase-11, and TNFα (Figure 2—figure supplement 2), and our results above suggest that these mice might be highly susceptible to infection.

We infected WT B6 mice and Casp1/11–/–Casp8+/–Ripk3–/–, Casp1/11+/–Casp8–/–Ripk3–/–, and Casp1/11/8–/–Ripk3–/– littermates that had been co-housed with the WT mice and assessed disease phenotypes across all four genotypes (Figure 8). We found that Casp1/11+/–Casp8–/–Ripk3–/– mice largely phenocopied WT B6 mice, and were resistant to infection, exhibiting minimal weight loss, diarrhea, cecal or colonic shrinkage, and no fecal blood (Figure 8A, B, D, E, F, I). Furthermore, we could not detect significant increases in bacterial burdens in the intestinal epithelium (Figure 8C) nor inflammatory cytokines (Figure 8G and H) in Casp1/11+/–Casp8–/–Ripk3–/– mice. These results suggest that Caspase-8 and RIPK3 are not necessary for resistance to Shigella in the presence of functional NLRC4–CASP1 and CASP11 inflammasomes. Interestingly, Casp1/11–/–Casp8+/–Ripk3–/– mice were not fully resistant to disease and experienced modest but significant weight loss (~5% relative to WT) and significant increases in cecal and colonic shrinkage (Figure 8B, E and F). These mice also exhibited trending but insignificant increases in diarrhea, inflammatory cytokines CXCL1 and IL-1β, and fecal blood (Figure 8D, G, H, I). This result indicates that Caspase-8 is not sufficient to render mice fully resistant to Shigella infection, perhaps because it is antagonized by Shigella effector OspC1, which suppresses Caspase-8 activity in human cell lines (Ashida et al., 2020).

Figure 8
Download asset Open asset
Loss of multiple cell death pathways renders mice hyper-susceptible to Shigella.

(A–I) B6.WT mice (black, n=8) were co-housed with B6.Casp8–/–Ripk3–/– (B6. Casp1/11+/–Casp8–/–Ripk3–/–, maroon, n=10), B6.Casp1/11–/–Ripk3–/– (B6.Casp1/11–/–Casp8+/–Ripk3, teal, n=11), and B6.Casp1/11/8–/–Ripk3–/– (light blue, n=10) littermates and treated orally with 25 mg streptomycin sulfate in water and orally challenged the next day with 107 colony forming units (CFUs) of wild-type (WT) Shigella flexneri. Mice were sacrificed at 2 days post-infection. (A) Representative images of the cecum and colon of infected B6.WT, B6.Casp8–/–Ripk3–/–, B6.Casp1/11–/–Ripk3–/–, and Casp1/11/8–/–Ripk3–/– mice. Note the severe inflammation in the Casp1/11/8–/–Ripk3–/– mice (left-most organs). (B) Mouse weights from 0 through 2 days post-infection. Each symbol represents the mean for all mice of the indicated group. (C) Shigella CFUs per million cells from the combined intestinal epithelial cell (IEC) enriched fraction of gentamicin-treated cecum and colon tissue. (D) The ratio of fecal pellet weight when wet (fresh) divided by the fecal pellet weight after overnight drying. Pellets were collected at day 2 post-infection. (E, F) Quantification of cecum and colon lengths normalized to mouse weight prior to infection; cecum or colon length (cm)/mouse weight (g). (G, H) CXCL1 and IL-1β levels measured by ELISA from homogenized cecum and colon tissue of infected mice. (I) Blood scores from feces collected at 2 days post-infection. 1=occult blood, 2=macroscopic blood. (C–I) Each symbol represents one mouse. Data collected from two independent experiments. Mean ± SD is shown in (B, D–H). Geometric mean ± SD is shown in (C). Statistical significance was calculated by one-way ANOVA with Tukey’s multiple comparison test (B (day 2), C–H) and by Fisher’s exact test in (I) where data were stratified by presence (score = 1 or 2) or absence (score = 0) of blood. Data were log-transformed prior to calculations in (C, D) to achieve normality. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns = not significant (p>0.05).

The most striking observation was that Casp1/11/8–/–Ripk3–/– mice were highly susceptible to Shigella infection, exhibiting severe weight loss (~15% of starting weight), diarrhea, and cecal and colonic shrinkage (Figure 8A, B and D–F). These mice also exhibited a massive (>500×) increase in bacterial colonization of the intestinal epithelium (Figure 8C) and elevated levels of inflammatory cytokines (Figure 8G and H). All Casp1/11/8–/–Ripk3–/– mice presented with blood in their feces (Figure 8I) and one of the ten mice also died of shigellosis within 2 days of infection. The ceca and colons of Casp1/11/8–/–Ripk3–/– mice were highly inflamed – the tissue thickened, turned white, and sections of the epithelium appeared to have been shed into the lumen, which was completely devoid of feces and filled instead with neutrophilic pus (Figure 8A). While the most significant inflammation in B6.Nlrc4–/– mice is typically seen in the cecum (Mitchell et al., 2020), we noted that the colon of Casp1/11/8–/–Ripk3–/– mice was highly inflamed as well (Figure 8A and F), suggesting that a protective role for Caspase-8 might be most important in this organ. The striking difference in susceptibility between Casp1/11–/–Casp8+/–Ripk3–/– and Casp1/11/8–/–Ripk3–/– suggests that any inhibition of Caspase-8 by OspC1, if present, is modest. Indeed, the activity of this effector might be specific to human cells.

Taken together, our results imply that redundant cell death pathways protect mice from disease upon oral Shigella challenge. Genetic removal of three caspases essential to this response leads to severe shigellosis. However, removal of one or two caspases critical to this response does not lead to severe disease because of significant compensation from the other pathway(s). We observe a hierarchical importance of the cell death pathways, namely, NLRC4>CASP11>TNFα–CASP8 (Figure 2—figure supplement 2). We speculate that this hierarchy may be established by the order in which a pathway can sense invasive Shigella within the epithelium and initiate a cell death response.

Discussion

We have previously shown that IEC expression of the NAIP–NLRC4 inflammasome is sufficient to confer resistance to shigellosis in mice (Mitchell et al., 2020). Activation of NAIP–NLRC4 by Shigella drives pyroptosis and expulsion of infected IECs. Genetic removal of NAIP–NLRC4 from IECs allows Shigella to colonize the intestinal epithelium, an event which drives intestinal inflammation and disease. Mouse IECs, however, deploy additional initiators of programmed cell death (Patankar and Becker, 2020) and it remained an open question whether these cell death pathways might also counteract Shigella.

We utilized the natural variation in 129.Nlrc4–/– mice, which lack functional CASP11 (Kayagaki et al., 2011), to show that CASP11 partially controls the difference in susceptibility between 129.Nlrc4–/– and B6.Nlrc4–/– mice (Figure 1, Figure 1—figure supplement 1). In F1 129/B6.Nlrc4–/–×129.Nlrc4–/– backcrossed mice, which were either 129/129 or B6/129 at the Casp11 locus, increased disease severity and colonization of the intestinal epithelium was associated with a homozygous null Casp11129 locus. We also investigated the role of Hiccs, a locus present in 129 mice that confers increased susceptibility to H. hepaticus-induced colitis (Boulard et al., 2012). The 129 Hiccs locus contains polymorphisms in the Alpk1 gene which encodes alpha-kinase 1 (ALPK1), an activator of NF-κB which has been shown to sense Shigella-derived ADP-heptose in human cells (Zhou et al., 2018). However, we did not find evidence that the natural variation in Hiccs in 129 versus B6 mice contributed to differences in susceptibility between the two strains (Figure 1—figure supplement 2).

We observed that ΔospC3 Shigella is significantly attenuated in B6.Nlrc4–/– mice but not in B6.Nlrc4–/–Casp11–/–, indicating by a ‘genetics squared’ analysis (Persson and Vance, 2007) that Shigella effector OspC3 inhibits CASP11 during oral mouse infection (Figures 3 and 4). The striking decrease in colonization of the intestinal epithelium in ΔospC3-infected B6.Nlrc4–/– mice relative to ΔospC3-infected B6.Nlrc4–/–Casp11–/– mice suggests that CASP11-dependent protection is epithelial-intrinsic. Shigella also deploys an effector, IpaH7.8, which degrades human (but not mouse) GSDMD to block pyroptosis, further underscoring the importance of this axis in defense (Luchetti et al., 2021). We note that CASP11-dependent protection is not sufficient to render ΔospC3-infected B6.Nlrc4–/– mice fully resistant to disease symptoms, perhaps because the priming required to induce CASP11 expression might delay its protective response (Oh et al., 2021).

Despite its role as a key cell death initiator in the gut (Patankar and Becker, 2020; Piguet et al., 1998; Ruder et al., 2019), TNFα has not yet been shown to play a major role in defense against pathogens that colonize the intestinal epithelium. Indeed, its role is usually reported to be detrimental to the host. For example, TNFα is a major driver of pathology during Crohn’s disease (van Dullemen et al., 1995). In the context of Salmonella infection, TNFα appears to drive widespread pathological death and dislodgement of IECs at 72 hr post-infection (Fattinger et al., 2021). Here, we show that TNFα is protective during oral Shigella infection, providing a rationale for why this cytokine is produced in the intestine. In both B6.Nlrc4–/–Casp11–/– and 129.Nlrc4–/– mice, TNFα neutralization led to a striking increase in severity of infection and a 10-fold increase in bacterial colonization of the intestinal epithelium (Figure 7, Figure 7—figure supplement 1).

TNFα-dependent protection might occur via an NF-κB-dependent, pro-inflammatory response from infected or bystander IECs that express TNFRI or by TNFRI-CASP8-dependent apoptosis of infected cells. Given the redundant, overlapping functions of both Caspase-11 and TNFα in the absence of NLRC4, we favor the hypothesis that TNFα promotes epithelial defense by initiating IEC apoptosis of infected cells in which NF-κB signaling is blocked (Ashida et al., 2010; Ashida et al., 2013; de Jong et al., 2016; Kim et al., 2005; Newton et al., 2010; Sanada et al., 2012; Wang et al., 2013). NF-κB-dependent cytokines IL-1β and CXCL1 increase after TNFα neutralization, hinting that protection might not be driven by the TNFα-dependent activation of NF-κB. However, this interpretation is complicated by the fact that bacterial burdens also increase and might drive the observed increases in NF-κB-dependent cytokines via an alternate mechanism. An important next step will be to associate TNFα-dependent protection with expulsion of infected IECs in the mouse gut or in IEC organoid cultures. Co-staining for cleaved Caspase-8 in these experiments would further support our hypothesis that TNFα promotes clearance of Shigella via extrinsic apoptosis. Identification of Shigella effectors (Ashida et al., 2010; Ashida et al., 2013; de Jong et al., 2016; Kim et al., 2005; Newton et al., 2010; Sanada et al., 2012; Wang et al., 2013) that block mouse NF-κB signaling and promote apoptosis of infected cells in vivo is the subject of ongoing investigation. Indeed, existing reports that Shigella suppresses CASP8–dependent apoptosis in human epithelial cells further implicate this cell death pathway in defense (Ashida et al., 2020; Faherty et al., 2010).

We find that Casp1/11/8–/–Ripk3–/– mice, which lack the pathways to execute pyroptosis, extrinsic apoptosis, and necroptosis, experience severe shigellosis with a 500-fold increase in colonization of the intestinal epithelium relative to B6 WT mice (Figure 8). Although we did not directly compare the two mouse strains, Casp1/11/8–/–Ripk3–/– mice (Figure 8) experienced more severe disease and epithelial colonization than Nlrc4–/–Casp11–/– mice (Figures 2, 4 and 7). We speculate that the additional susceptibility of Casp1/11/8–/–Ripk3–/– mice results from the absence of TNFRI–CASP8-dependent apoptosis and possibly from the absence of RIPK3-dependent necroptosis. While both apoptosis and necroptosis appear to be blocked in human cells by Shigella effectors OspC1 and OspD3, respectively (Ashida et al., 2020), the critical protective role of Caspase-8 in the absence of Caspase-1, Caspase-11, and RIPK3 suggests that this cell death initiator is not strongly antagonized by OspC1 in mice. Robust CASP8-dependent activity might intrinsically prevent necroptosis (Jorgensen et al., 2017; Wen et al., 2017), thus rendering OspD3 unimportant in the context of mouse Shigella infection, regardless of its ability to target mouse RIPK1 and RIPK3. We do observe that Casp1/11–/–Casp8+/–Ripk3–/– are modestly susceptible to infection while Casp1/11+/–Casp8–/–Ripk3–/– mice are fully resistant. This difference might be the result of a modest and incomplete CASP8 blockade by OspC1, as described above, or because NLRC4–CASP8-dependent cell death is delayed relative to NLRC4–CASP1-dependent cell death (Lee et al., 2018; Rauch et al., 2017). In addition, we note that CASP8 is a pleiotropic enzyme and might contribute to defense against Shigella via a mechanism that is independent of TNFα or NLRC4-dependent cell death (Gitlin et al., 2020; Philip et al., 2016; Schwarzer et al., 2020; Stolzer et al., 2022; Weng et al., 2014; Woznicki et al., 2021).

Despite the commonly held belief that macrophage pyroptosis and IL-1 signaling drive Shigella pathogenesis (Schnupf and Sansonetti, 2019; Schroeder and Hilbi, 2008), we find no major protective or pathogenic role for either during Shigella infection (Figures 5 and 6). These data suggest that epithelial-specific cell death and expulsion may be the key mechanism that protects mice from Shigella. Infections in IL-18-deficient mice will further clarify the role of inflammasome-dependent cytokines in protection. Additional studies in bone marrow chimeric mice or tissue-specific knockout mice are required to genetically confirm whether the protective effects of CASP11 and TNFα are epithelial-intrinsic. While we infer that cell death in the intestinal epithelium is the protective mechanism downstream of both CASP11 and TNFα, further experiments are required to directly observe and quantify differences in these modes of cell death in vivo.

Taken together, our experiments suggest the existence of a layered cell death pathway hierarchy (NLRC4>CASP11>TNFα–CASP8) that is essential in defense against oral Shigella infection in mice. Our work highlights both the importance of redundant layers of immunity as a strategy to counteract intracellular pathogens and the significant evolutionary steps required by Shigella to overcome these pathways and cause disease in humans. We observed a correlation between bacterial burdens in IECs and pathogenicity in our experiments, indicating that the extent to which Shigella can colonize the intestinal epithelium dictates the severity of disease during infection. However, the sensors within IECs that initiate inflammation and drive pathogenicity in vivo have yet to be uncovered and might present an ideal pharmacological target to limit pathological inflammation during acute Shigella infection.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Mus musculus, C57BL/6J)WTJax and Vance Lab colony, Jax stock No. 000664
Strain, strain background (Mus musculus, C57BL/6J)Nlrc4–/–Vance Lab colony Tenthorey et al., 2020Crossed to 129. Nlrc4–/– mice for mapping studies
Strain, strain background (Mus musculus, C57BL/6J)Casp11–/–Vance Lab colony, this paper
Strain, strain background (Mus musculus, C57BL/6J)Il1r1–/–Jax and Vance Lab colony, Jax stock No. 003245
Strain, strain background (Mus musculus, C57BL/6J)Casp1/11/8–/–
Ripk3–/–		Vance Lab colony Rauch et al., 2017
Strain, strain background (Mus musculus, C57BL/6J and C57BL/6N mixed)Rosa26LSL-Nlrc4 (formerly called iNlrc4)Vance Lab colony Rauch et al., 2017Encode a Cre-inducible Nlrc4 gene in the Rosa26 locus
Strain, strain background (Mus musculus, C57BL/6J)Lyz2CreJax and Vance Lab Colony, Jax stock No. 004781
Strain, strain background (Mus musculus, 129S1/SvImJ)WTJax and Vance Lab colony, Jax stock No. 002448
Strain, strain background (Mus musculus, 129S1/SvImJ)Nlrc4–/–Vance Lab colony Mitchell et al., 2020Crossed to B6. Nlrc4–/– mice for mapping studies
Strain, strain background (Shigella flexneri serovar 2a)WT 2457TLesser LabStreptomycin resistant
Strain, strain background (Shigella flexneri serovar 2a)ΔospC3 2457TLesser Lab Mou et al., 2018Streptomycin resistant
AntibodyRat anti-mIL-1β capture and goat anti-mIL-1β polyclonal detection antibodiesR&DDY401For ELISA (each used at 100 µL per well)
AntibodyRat anti-mCXCL1 capture and rat anti-mCXCL1 detection antibodiesR&DDY453For ELISA (each used at 100 µL per well)
AntibodyGoat anti-mMPO capture and goat anti-mMPO detection antibodiesR&DDY3667For ELISA (each used at 100 µL per well)
AntibodyMonoclonal anti-TNFα capture and detection antibodiesThermo FisherBMS607HSFor ELISA. Capture antibody is precoated on purchased plates, detection antibody used at 50 µL per well
AntibodyHamster anti-TNFα monoclonal neutralizing antibodyBio X cellTN3-19.12In vivo treatments, 200 μg daily
AntibodyPolyclonal Armenian hamster IgG isotype controlBio X cellBE0091In vivo treatments,, 200 μg daily
AntibodyRat anti-mCasp11 monoclonal antibodyNovus17D91:500

Animal procedures

Request a detailed protocol

All mice were maintained in a specific pathogen-free colony until 1–8 weeks prior to infection, maintained under a 12 hr light-dark cycle (7 am to 7 pm), and given a standard chow diet (Harlan irradiated laboratory animal diet) ad libitum. Animals used in infection experiments were littermates or, if not possible, were generally co-housed upon weaning. In cases when mice were not co-housed upon weaning, mice were co-housed for at least 3 weeks prior to infection. Co-housing was strategically performed to maximize cage overlap between all experimental groups. Different experimental treatments (comparing disease across different Shigella genotypes or antibody treatments) were stratified within mouse genotypes of the same litter, where possible, to ensure that phenotypes were not the result of the differences in different litter microbiomes. Mice were transferred from an SPF colony to an ABSL2 facility at least 1 week prior to infection. All mouse infections complied with the regulatory standards of, and were approved by, the University of California, Berkeley Animal Care and Use Committee. B6.Nlrc4–/– (C57BL/6J background) and 129.Nlrc4–/– (129S1/SvImJ background) mice were generated as previously described (Mitchell et al., 2020; Tenthorey et al., 2020). F1 129/B6.Nlrc4–/– were generated by crossing parental 129.Nlrc4–/– and B6.Nlrc4–/– mice. F1 129/B6.Nlrc4–/– mice were crossed to parental 129.Nlrc4–/– mice to generate backcrossed mice that were either B6/129 or 129/129 at each locus. 129 and B6 Casp11 alleles were distinguished by PCR and sequencing using the primers B6.129_Casp11_F 5’ GTTATCTATCAGTAGGAAGTGG 3’ and B6.129_Casp11_R 5’ AAACTAATACTTCTTATGAGAGC 3’; 129 mice have a distinguishable 5 bp deletion encompassing the exon 7 splice acceptor junction (Kayagaki et al., 2011). The Hiccs locus was genotyped by PCR using the primers D3Mit348_F 5’ CATCATGCATACTTTTTTCCTCA 3’, D3Mit348_R 5’ GCCAAATCATTCACAGCAGA 3’, D3Mit319_F 5’ TCTCCCTCACTTTTTCCTTCC 3’, and D3Mit319_R 5’ AACAGCCAGTCCAGCAAATC 3’ to distinguish polymorphisms between the B6 and 129 alleles. B6.Nlrc4–/–Casp11–/– animals were generated by targeting Casp11 via CRISPR-Cas9 mutagenesis in existing B6.Nlrc4–/– mice. CRISPR/Cas9 targeting was performed by electroporation of Cas9 protein and sgRNA into fertilized zygotes, essentially as described previously (Chen et al., 2016). Founder mice were genotyped by PCR and sequencing using the primers: Casp4_F 5’ GTCTTTAGCCCTTGAGAAGGACAC 3’ and Casp4_R 5’ CACCCCTTCACTTGAGTTTCTCC 3’. Founders carrying mutations were bred one generation to B6.Nlrc4–/– mice to separate modified haplotypes. Homozygous lines were generated by interbreeding heterozygotes carrying matched haplotypes. Mice harboring a loxP-STOP-loxP-Nlrc4 transgene integrated into the Rosa26 locus (Rosa26LSL-Nlrc4 mice) (Rauch et al., 2017) were previously described. Rosa26LSL-Nlrc4 mice were crossed to the B6.Nlrc4–/– line and then further crossed to Lyz2Cre (Jax strain 004781) transgenic lines on a B6.Nlrc4–/– background to generate Nlrc4–/–Rosa26LSL-Nlrc4Lyz2Cre mice that we refer to here as iNlrc4+Lyz2Cre+ mice. Nlrc4–/–Il1r1–/– mice were generated by crossing B6.Nlrc4–/– mice to B6.Il1r1–/– mice (Jax strain 003245). B6.Casp8–/–Ripk3–/–, B6.Casp1/11–/–Ripk3–/–, and B6.Casp1/11/8–/–Ripk3–/– mice were generated as previously described (Rauch et al., 2017).

Shigella strains

Request a detailed protocol

Mouse infections were conducted with the S. flexneri serovar 2a 2457T strain, WT or ΔospC3 (Mou et al., 2018). Natural streptomycin-resistant strains of WT and ΔospC3 were generated by plating cultured bacteria on tryptic soy broth (TSB) plates containing 0.01% Congo red (CR) and increasing concentrations of streptomycin sulfate. Streptomycin-resistant strains were confirmed to grow indistinguishably from parental strains in TSB broth lacking antibiotics, indicating an absence of streptomycin dependence.

In vivo Shigella infections and treatments

Request a detailed protocol

Streptomycin-resistant S. flexneri was grown at 37°C on tryptic soy agar plates containing 0.01% CR, supplemented with 100 μg/mL of streptomycin sulfate. For infections, a single CR-positive colony was inoculated into 5 mL TSB and grown shaking overnight at 37°C. Saturated cultures were back-diluted 1:100 in 5 mL fresh TSB shaking for 2–3 hr at 37°C. The approximate infectious dose was determined by spectrophotometry (OD600 of 1=108 CFU/mL). Bacteria were pelleted at 5000×g, washed twice in PBS, and suspended in PBS for infection by oral gavage. Actual infectious dose was determined by serially diluting a fraction of the initial inoculum and plating on TSB plates containing 0.01% CR and 100 μg/mL streptomycin. Mouse infections were performed in 6- to 22-week-old mice. Initially, mice deprived of food and water for 4–6 hr were orally gavaged with 100 μL of 250 mg/mL streptomycin sulfate dissolved in water (25 mg/mouse) and placed in a cage with fresh bedding. One day later, mice again deprived of food and water for 4–6 hr were orally gavaged with 100 μL of log-phase, streptomycin-resistant S. flexneri suspended in PBS at a dose of 108 CFU/mL (107 CFU/mouse). Mouse weights and fecal pellets were recorded or collected daily from 1 day prior to infection to the day of euthanasia and harvest to assess the severity of disease and biomarkers of inflammation. Fecal colonization (CFU/g of feces) and successful challenge were determined by homogenizing feces collected 1 day post-infection and plating (see below). In rare cases when mouse feces were not colonized with Shigella, mice were omitted from analysis. For each mouse infection experiment, at least three mice were included in each experimental group. All mouse infection experiments were repeated at least one time (with the exception of Figure 1, Figure 1—figure supplement 1, and Figure 1—figure supplement 2). Blinding and randomization were applied when co-housing mice and ARRIVE guidelines were applied when applicable. Each mouse had a unique numbered ear-tag identifier that was only associated with a treatment group or genotype following data collection. For in vivo antibody treatments, 200 µg of anti-TNFα antibody (Bio X Cell, clone TN3-19.12) and polyclonal Armenian hamster IgG isotype control antibody (Bio X Cell) were administered by intraperitoneal injection daily starting 1 day prior to infection.

Fecal CFUs, fecal MPO ELISAs, wet/dry ratio, fecal blood

Request a detailed protocol

Fecal pellets were collected in 2 mL tubes, suspended in 1 mL of 2% FBS in PBS containing protease inhibitors, and homogenized using a polytron homogenizer at 18,000 rpm. For CFU enumeration, serial dilutions were made in PBS and plated on TSB plates containing 0.01% CR and 100 mg/mL streptomycin sulfate. For MPO ELISAs, fecal homogenates were spun at 2000×g and supernatants were plated in duplicate on absorbent immunoassay 96-well plates. Recombinant mouse MPO standard, MPO capture antibody, and MPO sandwich antibody were purchased from R&D Systems. Wet/dry ratios were determined by weighing fecal pellets before and after they had been dried in a fume hood. The presence or absence of fecal blood in fresh pellets was determined by macroscopic observation or by applying wet fecal samples to detection tabs from a Hemoccult blood testing kit (Beckman Coulter).

Intestinal CFU determination

Request a detailed protocol

To enumerate intracellular Shigella CFU from the IEC fraction of mouse ceca and colons, organs were removed from mice upon sacrifice, cut longitudinally and removed of luminal contents by washing in PBS. Tissues were placed in 14 mL culture tubes, incubated in RPMI with 5% FBS, 2 mM L-glutamine, 25 mM HEPES, and 400 μg/mL of gentamicin for 1–2 hr, and vortexed briefly. Tissues were then washed five times in PBS, cut into 1 cm pieces, placed in 15 mL of stripping solution (HBSS, 10 mM HEPES, 1 mM DTT, 2.6 mM EDTA), and incubated at 37°C for 25 min with gentle agitation. Supernatants were passed through a 100 µm filter and the remaining pieces of tissue were shaken vigorously in a 50 mL conical with 10 mL of PBS and passed again through the 100 µm filter. This enriched epithelial cell fraction was incubated in 50 μg/mL gentamicin for 30–40 min on ice, spun at 300×g at 4°C for 8 min, and washed twice by aspirating the supernatant, resuspending in PBS, and spinning at 300×g at 4°C for 5 min. After the first wash, a fraction of cells were set aside to determine the cell count. After the second wash, the pellet was resuspended and lysed in 1 mL of 1% Triton X-100. Serial dilutions were made from this solution and plated on TSB agar plates containing 0.01% CR and 100 μg/mL streptomycin and CR+ positive colonies were counted following overnight incubation at 37°C.

Tissue ELISAs

Request a detailed protocol

After isolating the IEC fraction (above), the remaining tissue was transferred to a 14 mL culture tube containing 1 mL of PBS containing 2% FBS and protease inhibitors. Organs were homogenized using a polytron homogenizer at 20,000 rpm, centrifuged at 2000×g, and supernatants were plated on absorbent immunoassay 96-well plates. Recombinant mouse CXCL1 and IL-1β standards, capture antibodies, and sandwich antibodies were purchased from R&D. TNFα levels were detected using a high sensitivity ELISA from Thermo Fisher (order no: BMS607HS).

Immunoblot and antibodies

Request a detailed protocol

Lysates were prepared from Casp11+/– and Casp11–/– mouse bone marrow-derived macrophages and clarified by spinning at 16,100×g for 10 min at 4°C. Clarified lysates were denatured in SDS loading buffer. Samples were separated on NuPAGE Bis-Tris 4–12% gradient gels (Thermo Fisher) following the manufacturer’s protocol. Proteins were transferred onto Immobilon-FL PVDF membranes at 375 mA for 90 min and blocked with Odyssey blocking buffer (Li-Cor). Proteins were detected on a Li-Cor Odyssey Blot Imager using an anti-Caspase-11 primary antibody (cone 17D9) and Alex Fluor-680 conjugated secondary antibody (Invitrogen).

Statistical analysis

Request a detailed protocol

Statistical significance was determined using Prism (GraphPad) software for unpaired, two-tailed Mann-Whitney test when comparing two groups, one-way or two-way ANOVA tests with Tukey’s multiple comparisons test when comparing multiple groups, and Fisher’s exact test when comparing categorical data (for fecal blood scores). For some ANOVA calculations, non-normal data was first log-transformed to achieve normality (see figure legends). For Fisher’s exact tests, data were stratified into two groups by presence (score = 1 or 2) or absence (score = 0) of blood. Each Fisher’s exact test was performed independently between the experimental groups indicated in the figures.

Materials availability statement

Request a detailed protocol

All materials used, including Shigella strains and mouse lines, are available on request. Please contact corresponding author Russell E Vance.

Data availability

All data generated or analysed during this study are included in the manuscript or have been deposited with Dryad at https://doi.org/10.6078/D1S13W.

The following data sets were generated
    1. Vance RE
    2. Roncaioli J
    (2023) Dryad Digital Repository
    Data from: A hierarchy of cell death pathways confers layered resistance to shigellosis in mice.
    https://doi.org/10.6078/D1S13W

References

Decision letter

  1. Arturo Casadevall
    Senior and Reviewing Editor; Johns Hopkins Bloomberg School of Public Health, United States
  2. Edward A Miao
    Reviewer; Duke University, United States

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "A hierarchy of cell death pathways confers layered resistance to shigellosis in mice" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Arturo Casadevall as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Edward A Miao (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) Please address concerns about the rigor of the statistical analysis

2) Please address the multiple requests for clarification about experimental details and text from all three reviewers.

Reviewer #2 (Recommendations for the authors):

1. Is epithelial cell death further defective in Nlrc4-/-Casp11-/- and Casp1/11/8-/- Ripk3-/- mice compared to Nlrc4-/- mice? An experimental quantification of epithelial cell death in vivo would strengthen the paper, such as immunohistochemistry or immunofluorescence microscopy for cleaved caspase-3. However, this reviewer recognizes that this is potentially challenging to address in vivo, but such assays have been performed in published studies (ie PMID 31606566). Alternatively, the authors could show effects on cell death and extrusion in cultured epithelial cells, similar to their previous studies (Mitchell and Roncaioli et al. 2020,, Rauch et al., 2017).

2. The claim made in the discussion that the mechanism of TNF⍺-mediated anti-Shigella defense is "not likely driven by TNF⍺-dependent activation of NF-κB" may be overstated because caspase-8 can drive NF-κB activation and cytokine production in various settings, which the authors. Additionally, the increased bacterial burdens in caspase-8-deficient mice and mice treated with anti-TNF⍺ confound the interpretation of increased cytokine production. Experimentally, this could be addressed by measuring cell-intrinsic cytokine production by flow cytometry at a timepoint or tissue where the bacterial burdens are equal between groups. Alternatively, the authors could modify the text of the discussion by acknowledging the alternative interpretation to include the possibility that NF-κB activation downstream of TNF⍺ signaling may contribute to bacterial control.

The recommendations below would strengthen the paper but are not critical to support the conclusions of the study. Whether to address these points experimentally or by appropriate modification of the text should be left to the discretion of the authors.

1. The claim in Figure 2 that the caspase-11 inflammasome "prevents disease" in Nlrc4-deficient mice, as phrased in the figure legend seems like it may be an overstatement, or at least not nuanced enough given the data. In particular, there is no difference in weight, and just 2/9 mice had blood in the gut, making it not possible to make a robust statistical conclusion from these data. A possible explanation is contained subsequently within the paper itself, in that OspC3 efficiently blocks Casp-11 activation, likely masking anti-bacterial effects of Casp-11. Based on this, the description of Figure 2 in the text may benefit from modification in light of this possible interpretation.

2. What happens at later timepoints to Casp1/11/8-/- Ripk3-/- mice? Do they eventually recover their weight and diarrhea like previously shown in 129.Nlrc4-/- mice (Mitchell and Roncaioli et al. 2020), or do they succumb to infection? If the authors already have this data, it would further define the nature of the increased susceptibility of these mice. However, this experiment is not essential to the claims of the paper.

3. Statistical recommendations:

a. Figure 5: Please provide statistics comparing WT and iNlrc4Lyz2Cre groups in all panels.

b. For statistical analyses involving more than two groups, please use a test that corrects for multiple comparisons (particularly in Figures 4 and 8).

c. The authors may consider using a statistical test in occult blood analyses, such as a Fisher's exact test, which can analyze categorical data.

Reviewer #3 (Recommendations for the authors):

Introduction states that T3SS mediates actin-based motility, but I think this is primarily IcsA dependent, which I think is not a T3SS effector.

In the figure 1 legend the authors should state that this is experiment is representative of 1 experiment. We, the readers, should not infer this by omission.

Please add the "129S1/SvImJ" full strain name to the methods section.

The authors should state that CXCL1 is measured as markers of disease rather than as specific mediators to be investigated in this paper. Figure 1d shows an ELISA for IL-1β from tissue homogenate. This signal could arise from either pro-IL-1β or mature IL-1β. If the ELISA has the ability to detect both forms, then this may be a marker for NF-κB responses rather than caspase-1 activation. The authors make no claims either way. They should simply comment on this in the text, as this is not discussed currently.

Figure 1 paragraph 2: "mixed homozygous 129/129 or heterozygous B6/129 at all loci". This is not correct, please revise.

The way this data is discussed in the text, and presented in the figure legends (Figure 1 and Figure 1--supplementary figure 2) is incorrect. To my understanding, the data in these two figures are the same data but groups split different based on Casp11 vs Hiccs genotypes. The legend needs to clearly state that it is the same data. In fact, all the details of the supplementary label could be removed, simply referring to figure 1. This would make it even more clear that it is the same experimental data. This can also be facilitated by more clear writing and transition sentences in the main text.

Figure 1 should be relabeled so it is more clear that the groups "129/129 at Casp11" and "B6/129 at Casp11" are also deficient for Nlrc4. Perhaps simply writing Nlrc4-/- across the bottom with a line over all the groups? Also check panel 1G label for consistency.

The interpretation for Figure 1c-1d-1e is not correct. The authors describe the genotypes N2 cross Casp11(129/129) mice as having "modest increases" in inflammatory cytokines and cecum shrinkage, however, the CXCL1 p value is 0.09, which could be described as trending but not statistically significant, the IL-1b levels are not different by eye, and the cecum length perhaps is trending.

Figure 2E is statistically significant in the difference, but Figure 2F is only trending, so this needs to be stated correctly in the text.

Figure 3B and 3D are paired in the sentence when discussed, but 3B is significant and 3D is trending.

Figure 3F and 3G are again paired in the sentence as being "reduced levels", but 3F is significant and 3G is not even trending to different.

Figure 7A-E are described as "modest increases" however most of these are not statistically significant. There might be real differences there if the power of the experiment were doubled or tripled, however, this is probably not worth the effort. In comparison, Figure 6A has trending differences where IL-1R appears to have a trending detrimental effect on weight, but this is interpreted as not significantly different. This also might be significant with sufficient power, but again, not worth the effort to pursue that.

The authors are much more clear and precise in their interpretations of Figure 5F and 5G, this style should be applied to earlier figures. I may have missed other imprecise interpretations, please read each interpretation carefully to ensure they are correct.

Please add a statistical analysis section to the methods.

Regarding statistical analysis, in Figure 1A, the authors make an interpretation that the 129 parentals are the same as the N2 Casp11(129/129) and that the B6 parentals are the same as the N2 Casp11 (B6/129). However, the statistical analysis cannot use Mann-Whitney because 4 groups are being compared. If only day 3 was to be analyzed, then the authors need to use a one-way ANOVA. If time is added to this analysis, this is another variable added to the experiment, and requires a two-way ANOVA.

Figure 3, 4, 6, 7N legends state that a Mann-Whitney test was used for all data analyses, but the statistics show comparisons across more than two groups. A one-way ANOVA (or Kruskal-Wallis) is the correct analysis in this case.

There are no statistical analysis on the F1 mouse experiments in supplement figure 1, but conclusions are drawn from these experiments in the text so statistical analysis should be performed.

Many figures use littermates. The authors should state in the results text what the parent genotypes were. They also need to state the full genotype of each gene in the panel in the graphical figure. Heterozygous sufficiency cannot be assumed, and heterozygous states must be stated on each mouse. If all heterozygous mice were discarded and mice arise from het x het breeding, this should be stated for clarity so that a reader does not have this concern. For example in Figure 2 are the WT mice actually Nlrc4+/- and Casp11+/-, and are the Nlrc4-/- mice actually Nlrc4-/- Casp11+/- mice? Another example, in Figure 8, I can only imagine that all these mice are heterozygous at other loci that are not stated, ie the Casp8-/- Ripk3-/- mice are probably also Casp1/11+/-. The full genotype needs to be stated. Also, the legend makes it sound like the WT mice are also littermates. Are these heterozygous mice, or are they a non-co-housed WT control comparison group? This should be stated.

In the "loss of multiple cell death…" section for Figure 8, at the beginning of this section the authors have already introduced the concept that OspC3 is an incomplete inhibitor, and they have already introduced OspC1 and OspD3. Thus, my expectation in starting to read this section was that these might be incomplete inhibitors as well, but this was not mentioned. Also the discussion would benefit from direct naming and discussing these effectors. I would expect additional "genetics squared" phenotypes in future work that examined these mutants. In other words, stronger phenotypes may be observed for caspase-8 when examining an ospC1 mutant. Revision of the text would be helpful for the reader.

Fecal blood graphs use dots for each mouse, however, most graphs these dots coalesce and thus are not visible. The authors compensate by labelling the numbers of mice that have blood or not. Perhaps a different type of graph would more accurately convey the data. Perhaps diamonds would make it visible. Perhaps a y axis of percentage of mice, and then each genotype is a "stacked bar" with fecal blood scores. Or maybe a table inset in the figure?

Model in Figure Supplement 2, I think it would not take too much effort to add RIPK3, OspC1, and OspD3 to the figure, all are relevant to the manuscript. Also, if you rearrange to place the CASP11 module on the left, then you can remove the CASP8 from underneath NLRC4, instead drawing a line from NLRC4 to CASP8 that is under the TNF receptor (thus avoiding having CASP8 on the figure twice).

I suggest revising the text around the use of Casp8-/- Ripk3-/- mice. Currently, it seems that these mice only investigate caspase-8, and it is assumed that RIPK3 plays no role. However, the role for RIPK3 may only be apparent when Shigella inhibits caspase-8. Which it does with OspC1, thus explaining the existence of OspD3. Thus, most likely, both play a role, but the RIPK3 role is not apparent in a single knockout because caspase-8 is sufficient.

https://doi.org/10.7554/eLife.83639.sa1

Author response

Essential revisions:

1) Please address concerns about the rigor of the statistical analysis

2) Please address the multiple requests for clarification about experimental details and text from all three reviewers.

We thank all the reviewers for their constructive and detailed comments. We have made numerous changes addressing the statistics and experimental details in response to the critiques of all three reviewers. These changes are detailed below and we believe they have substantially improved the manuscript.

Reviewer #2 (Recommendations for the authors):

1. Is epithelial cell death further defective in Nlrc4-/-Casp11-/- and Casp1/11/8-/- Ripk3-/- mice compared to Nlrc4-/- mice? An experimental quantification of epithelial cell death in vivo would strengthen the paper, such as immunohistochemistry or immunofluorescence microscopy for cleaved caspase-3. However, this reviewer recognizes that this is potentially challenging to address in vivo, but such assays have been performed in published studies (ie PMID 31606566). Alternatively, the authors could show effects on cell death and extrusion in cultured epithelial cells, similar to their previous studies (Mitchell and Roncaioli et al. 2020,, Rauch et al., 2017).

We agree with the reviewer that an experimental quantification of cell death would strengthen the conclusions of the paper. We note that it is experimentally challenging to directly identify/quantify cell death in the intestinal epithelium in the context of Shigella infection. The ex vivo organoid epithelial cell system used in our previous studies was effective in part because there was a distinct and obvious difference in cell death between NLRC4-competent and NLRC4-deficient organoid monolayers, likely because NLRC4 strongly responds to a synchronized Shigella monolayer infection. However, the effects of CASP11 and TNF are more subtle than the effects of NLRC4 and may depend on cytokine responses that originate from hematopoietic cells (not present in organoids).

In Rauch et al. (2017), cell death was readily detectable because the administration of FlaTox allows for a synchronized, rapid, and potent cell death response. However, in the context of Shigella infection, although cell death appears important in limiting bacterial replication and dissemination in the epithelium, cell death events are not synchronized, occur less frequently, and are thus more difficult to visually capture. Furthermore, it is difficult to determine the pathway or sensors that initiate a given cell death pathway, as immunofluorescence for apoptotic, pyroptotic, and necroptotic markers and initiators is difficult to perform in vivo. Nonetheless, we hope to directly quantify cell death in vivo in our future work.

2. The claim made in the discussion that the mechanism of TNF⍺-mediated anti-Shigella defense is "not likely driven by TNF⍺-dependent activation of NF-κB" may be overstated because caspase-8 can drive NF-κB activation and cytokine production in various settings, which the authors. Additionally, the increased bacterial burdens in caspase-8-deficient mice and mice treated with anti-TNF⍺ confound the interpretation of increased cytokine production. Experimentally, this could be addressed by measuring cell-intrinsic cytokine production by flow cytometry at a timepoint or tissue where the bacterial burdens are equal between groups. Alternatively, the authors could modify the text of the discussion by acknowledging the alternative interpretation to include the possibility that NF-κB activation downstream of TNF⍺ signaling may contribute to bacterial control.

We agree with the reviewers that our claims regarding the role of TNF⍺ in protection are overstated in certain sections of the text. We have modified our Discussion section to include the possibility that this protection might occur through NFkB signaling and have further explained our thought process for why we hypothesize that protection is via apoptosis. We also now acknowledge the caveat that increased bacterial burdens in mice treated with anti-TNF⍺ confound the interpretation of increased cytokine production.

The recommendations below would strengthen the paper but are not critical to support the conclusions of the study. Whether to address these points experimentally or by appropriate modification of the text should be left to the discretion of the authors.

1. The claim in Figure 2 that the caspase-11 inflammasome "prevents disease" in Nlrc4-deficient mice, as phrased in the figure legend seems like it may be an overstatement, or at least not nuanced enough given the data. In particular, there is no difference in weight, and just 2/9 mice had blood in the gut, making it not possible to make a robust statistical conclusion from these data. A possible explanation is contained subsequently within the paper itself, in that OspC3 efficiently blocks Casp-11 activation, likely masking anti-bacterial effects of Casp-11. Based on this, the description of Figure 2 in the text may benefit from modification in light of this possible interpretation.

We have modified the title of this section and figure to reflect the modest effect that CASP11 has on protection in the presence of OspC3. We note that the significant increases in bacterial burden in IECs (Figure 2B) and CXCL1 indicate that CASP11 does still play a minor role in protection, even if this phenotype is not fully penetrant.

2. What happens at later timepoints to Casp1/11/8-/- Ripk3-/- mice? Do they eventually recover their weight and diarrhea like previously shown in 129.Nlrc4-/- mice (Mitchell and Roncaioli et al. 2020), or do they succumb to infection? If the authors already have this data, it would further define the nature of the increased susceptibility of these mice. However, this experiment is not essential to the claims of the paper.

We have occasionally observed death in both Casp1/11/8–/– Ripk3–/– and 129.Nlrc4–/– mice between 2 and 6 days following infection, however, we have not directly quantified these results as the purpose of these experiments were not to address survival rate in response to infection. We find that survival rate within these genotypes tends to vary between infections, suggesting that the microbiome (or other factors) might affect susceptibility to lethal infection. We intend to collect data for survival curves in future work.

3. Statistical recommendations:

a. Figure 5: Please provide statistics comparing WT and iNlrc4Lyz2Cre groups in all panels.

We have used a one way ANOVA with Tukey’s multiple comparison test to analyze these data for significance.

b. For statistical analyses involving more than two groups, please use a test that corrects for multiple comparisons (particularly in Figures 4 and 8).

We have updated the manuscript to include one and two way ANOVA tests with Tukey’s multiple comparisons when analyzing more than one group in specific experiments.

c. The authors may consider using a statistical test in occult blood analyses, such as a Fisher's exact test, which can analyze categorical data.

We used a Fisher’s exact test to analyze occult blood scores (with the exception of Figure 1 and Figure 1 —figure supplement 2, which uses a one-way ANOVA to analyze significance between our added blood scores). In our Fisher’s exact analyses, data was stratified into two groups by presence (score = 1 or 2) or absence (score = 0) of blood.

Reviewer #3 (Recommendations for the authors):

Introduction states that T3SS mediates actin-based motility, but I think this is primarily IcsA dependent, which I think is not a T3SS effector.

We have modified the introduction with this correction.

In the figure 1 legend the authors should state that this is experiment is representative of 1 experiment. We, the readers, should not infer this by omission.

We have modified the legend with this correction.

Please add the "129S1/SvImJ" full strain name to the methods section.

We have modified the methods section with this correction.

The authors should state that CXCL1 is measured as markers of disease rather than as specific mediators to be investigated in this paper. Figure 1d shows an ELISA for IL-1β from tissue homogenate. This signal could arise from either pro-IL-1β or mature IL-1β. If the ELISA has the ability to detect both forms, then this may be a marker for NF-κB responses rather than caspase-1 activation. The authors make no claims either way. They should simply comment on this in the text, as this is not discussed currently.

We have changed the text in the Results section to reflect that we use both IL-1b and CXCL1 as biomarkers of disease and not as specific mediators to be investigated. We also state that the ELISA does not distinguish between unprocessed and processed IL1b.

Figure 1 paragraph 2: "mixed homozygous 129/129 or heterozygous B6/129 at all loci". This is not correct, please revise.

We have corrected this in the text.

The way this data is discussed in the text, and presented in the figure legends (Figure 1 and Figure 1--supplementary figure 2) is incorrect. To my understanding, the data in these two figures are the same data but groups split different based on Casp11 vs Hiccs genotypes. The legend needs to clearly state that it is the same data. In fact, all the details of the supplementary label could be removed, simply referring to figure 1. This would make it even more clear that it is the same experimental data. This can also be facilitated by more clear writing and transition sentences in the main text.

Yes, the data in Figure 1 and Figure 1 — figure supplement 2 are the same. To clarify this, we have used more a more precise description of the experiments and data presentation in both the text and figure legends.

Figure 1 should be relabeled so it is more clear that the groups "129/129 at Casp11" and "B6/129 at Casp11" are also deficient for Nlrc4. Perhaps simply writing Nlrc4-/- across the bottom with a line over all the groups? Also check panel 1G label for consistency.

We have updated the figure legends in both Figure 1 and Figure 1 — figure supplement 2 to indicate that mice in these groups are also deficient for NLRC4. We have updated the label in panel 1G.

The interpretation for Figure 1c-1d-1e is not correct. The authors describe the genotypes N2 cross Casp11(129/129) mice as having "modest increases" in inflammatory cytokines and cecum shrinkage, however, the CXCL1 p value is 0.09, which could be described as trending but not statistically significant, the IL-1b levels are not different by eye, and the cecum length perhaps is trending.

We have changed our interpretations to reflect the reviewers comments.

Figure 2E is statistically significant in the difference, but Figure 2F is only trending, so this needs to be stated correctly in the text.

We have changed our interpretations to reflect the reviewers comments.

Figure 3B and 3D are paired in the sentence when discussed, but 3B is significant and 3D is trending.

We have changed our interpretations to reflect the reviewers comments and we note that after updating our statistical tests, data in Figure 3D are significant.

Figure 3F and 3G are again paired in the sentence as being "reduced levels", but 3F is significant and 3G is not even trending to different.

We have changed our interpretations to reflect the reviewers comments.

Figure 7A-E are described as "modest increases" however most of these are not statistically significant. There might be real differences there if the power of the experiment were doubled or tripled, however, this is probably not worth the effort. In comparison, Figure 6A has trending differences where IL-1R appears to have a trending detrimental effect on weight, but this is interpreted as not significantly different. This also might be significant with sufficient power, but again, not worth the effort to pursue that.

The authors are much more clear and precise in their interpretations of Figure 5F and 5G, this style should be applied to earlier figures. I may have missed other imprecise interpretations, please read each interpretation carefully to ensure they are correct.

We have modified our interpretations and language in the Results section for each figure so that they are both more accurate and precise.

Please add a statistical analysis section to the methods.

We have added a statistical analysis section to the methods.

Regarding statistical analysis, in Figure 1A, the authors make an interpretation that the 129 parentals are the same as the N2 Casp11(129/129) and that the B6 parentals are the same as the N2 Casp11 (B6/129). However, the statistical analysis cannot use Mann-Whitney because 4 groups are being compared. If only day 3 was to be analyzed, then the authors need to use a one-way ANOVA. If time is added to this analysis, this is another variable added to the experiment, and requires a two-way ANOVA.

We have re-analyzed the data (at day three) using a one-way ANOVA and Tukey’s multiple comparisons test.

Figure 3, 4, 6, 7N legends state that a Mann-Whitney test was used for all data analyses, but the statistics show comparisons across more than two groups. A one-way ANOVA (or Kruskal-Wallis) is the correct analysis in this case.

We have re-analyzed the data for these figures using one-way and two-way ANOVAs and Tukey’s multiple comparisons test. We used log transformation for data without a normal distribution (as indicated in the figure legends).

There are no statistical analysis on the F1 mouse experiments in supplement figure 1, but conclusions are drawn from these experiments in the text so statistical analysis should be performed.

We have now performed statistical analysis on the data generated for this figure.

Many figures use littermates. The authors should state in the results text what the parent genotypes were. They also need to state the full genotype of each gene in the panel in the graphical figure. Heterozygous sufficiency cannot be assumed, and heterozygous states must be stated on each mouse. If all heterozygous mice were discarded and mice arise from het x het breeding, this should be stated for clarity so that a reader does not have this concern. For example in Figure 2 are the WT mice actually Nlrc4+/- and Casp11+/-, and are the Nlrc4-/- mice actually Nlrc4-/- Casp11+/- mice? Another example, in Figure 8, I can only imagine that all these mice are heterozygous at other loci that are not stated, ie the Casp8-/- Ripk3-/- mice are probably also Casp1/11+/-. The full genotype needs to be stated. Also, the legend makes it sound like the WT mice are also littermates. Are these heterozygous mice, or are they a non-co-housed WT control comparison group? This should be stated.

We have modified both the text, figures, and figure legends to more accurately represent the mouse genotypes used in each study and whether mice were littermates or cohoused cage-mates.

In the "loss of multiple cell death…" section for Figure 8, at the beginning of this section the authors have already introduced the concept that OspC3 is an incomplete inhibitor, and they have already introduced OspC1 and OspD3. Thus, my expectation in starting to read this section was that these might be incomplete inhibitors as well, but this was not mentioned. Also the discussion would benefit from direct naming and discussing these effectors. I would expect additional "genetics squared" phenotypes in future work that examined these mutants. In other words, stronger phenotypes may be observed for caspase-8 when examining an ospC1 mutant. Revision of the text would be helpful for the reader.

We have revised both the Results section and the Discussion section to account for the potential role of effectors OspC1 and OspD3. While OspC1 and OspD3 appear to inhibit apoptosis and necroptosis in humans, however, we hypothesize that these effectors are less effective in mice. Our data indicates that CASP8 is indeed active during Shigella infection, and plays a strong role in defense. This would indicate that this enzyme is not strongly inhibited by OspC1. Furthermore, we predict that an active CASP8 pathway would intrinsically inhibit necroptosis, thus rendering OspD3 “obsolete” in mice.

Fecal blood graphs use dots for each mouse, however, most graphs these dots coalesce and thus are not visible. The authors compensate by labelling the numbers of mice that have blood or not. Perhaps a different type of graph would more accurately convey the data. Perhaps diamonds would make it visible. Perhaps a y axis of percentage of mice, and then each genotype is a "stacked bar" with fecal blood scores. Or maybe a table inset in the figure?

We considered presenting fecal blood scores as percentage or proportion bar graphs, however, we were unable to make a figure that could separate experimental groups by color and still effectively visually distinguish the three possible blood score outcomes from each other. We also found that have a full bar for mouse groups that did not experience blood appeared misleading. We have taken the advice of Reviewer #3 and used diamonds instead of circles to represent each mouse. Diamonds appear more distinct and separate then circles, although we acknowledge that this new visually representation is not perfect. Labeling the number of mice in each group adds to the visually representation to present a more clear picture.

Model in Figure Supplement 2, I think it would not take too much effort to add RIPK3, OspC1, and OspD3 to the figure, all are relevant to the manuscript. Also, if you rearrange to place the CASP11 module on the left, then you can remove the CASP8 from underneath NLRC4, instead drawing a line from NLRC4 to CASP8 that is under the TNF receptor (thus avoiding having CASP8 on the figure twice).

Our data suggest that CASP8 is not strongly inhibited by OspC1, and thus, we predict that necroptosis is not central to protection in mice. At a minimum, we have no evidence that necroptosis, OspC1 or OspD3 are important in mice. Thus we have decided to omit RIPK3, OspC1, and OspD3 from our figure and retain the initial figure.

I suggest revising the text around the use of Casp8-/- Ripk3-/- mice. Currently, it seems that these mice only investigate caspase-8, and it is assumed that RIPK3 plays no role. However, the role for RIPK3 may only be apparent when Shigella inhibits caspase-8. Which it does with OspC1, thus explaining the existence of OspD3. Thus, most likely, both play a role, but the RIPK3 role is not apparent in a single knockout because caspase-8 is sufficient.

We have revised the Results and Discussion section to include more detailed comments on the potential roles of RIPK3, OspC1, and OspC3 (see above) and our predictions about the role of each during mouse infection.

https://doi.org/10.7554/eLife.83639.sa2

Article and author information

Author details

  1. Justin L Roncaioli

    Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared

  2. Janet Peace Babirye

    Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared

  3. Roberto A Chavez

    Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared

  4. Fitty L Liu

    Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared

  5. Elizabeth A Turcotte

    Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared

  6. Angus Y Lee

    Cancer Research Laboratory, University of California, Berkeley, Berkeley, United States
    Contribution
    Resources
    Competing interests
    No competing interests declared

  7. Cammie F Lesser

    1. Department of Microbiology, Harvard Medical School, Boston, United States
    2. Broad Institute of Harvard and MIT, Cambridge, United States
    3. Department of Medicine, Division of Infectious Diseases, Massachusetts General Hospital, Boston, United States
    Contribution
    Resources, Supervision, Funding acquisition, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared

  8. Russell E Vance

    1. Division of Immunology & Molecular Medicine, Department of Molecular & Cell Biology, University of California, Berkeley, Berkeley, United States
    2. Cancer Research Laboratory, University of California, Berkeley, Berkeley, United States
    3. Immunotherapeutics and Vaccine Research Initiative, University of California, Berkeley, Berkeley, United States
    4. Howard Hughes Medical Institute, University of California, Berkeley, Berkeley, United States
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Writing - original draft, Writing - review and editing
    For correspondence
    rvance@berkeley.edu
    Competing interests
    Reviewing editor, eLife
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6686-3912

Funding

Howard Hughes Medical Institute

  • Russell E Vance

National Institutes of Health (AI075039)

  • Russell E Vance

National Institutes of Health (AI063302)

  • Russell E Vance

National Institutes of Health (AI155634)

  • Russell E Vance

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank P Mitchell, I Rauch, S Fattinger, and K Eislmayr for discussion and advice. We are grateful to members of the Vance and Barton Labs for discussions. Funding: REV is an HHMI Investigator, a recipient of HHMI EPI support, and supported by NIH grants AI075039, AI155634 and AI063302. JLR is an Irving H Wiesenfeld CEND Fellow; EAT is supported by NSF GRFP DGE 1752814; CFL is a Brit d’Arbeloff MGH Research Scholar and supported by NIH AI064285 and NIH AI128743.

Ethics

This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (AUP-2014-09-6665-1) of the University of California Berkeley.

Senior and Reviewing Editor

  1. Arturo Casadevall, Johns Hopkins Bloomberg School of Public Health, United States

Reviewer

  1. Edward A Miao, Duke University, United States

Publication history

  1. Preprint posted: September 21, 2022 (view preprint)
  2. Received: September 27, 2022
  3. Accepted: January 15, 2023
  4. Accepted Manuscript published: January 16, 2023 (version 1)
  5. Version of Record published: January 25, 2023 (version 2)

Copyright

© 2023, Roncaioli et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,124
    Page views
  • 131
    Downloads
  • 2
    Citations

Article citation count generated by polling the highest count across the following sources: PubMed Central, Crossref, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Justin L Roncaioli
  2. Janet Peace Babirye
  3. Roberto A Chavez
  4. Fitty L Liu
  5. Elizabeth A Turcotte
  6. Angus Y Lee
  7. Cammie F Lesser
  8. Russell E Vance
(2023)
A hierarchy of cell death pathways confers layered resistance to shigellosis in mice
eLife 12:e83639.
https://doi.org/10.7554/eLife.83639

Categories and tags

Research organism

Further reading

    1. Immunology and Inflammation
    2. Microbiology and Infectious Disease

    NAIP–NLRC4-deficient mice are susceptible to shigellosis

    Patrick S Mitchell, Justin L Roncaioli ... Russell E Vance
    Research Article Updated

    Bacteria of the genus Shigella cause shigellosis, a severe gastrointestinal disease that is a major cause of diarrhea-associated mortality in humans. Mice are highly resistant to Shigella and the lack of a tractable physiological model of shigellosis has impeded our understanding of this important human disease. Here, we propose that the differential susceptibility of mice and humans to Shigella is due to mouse-specific activation of the NAIP–NLRC4 inflammasome. We find that NAIP–NLRC4-deficient mice are highly susceptible to oral Shigella infection and recapitulate the clinical features of human shigellosis. Although inflammasomes are generally thought to promote Shigella pathogenesis, we instead demonstrate that intestinal epithelial cell (IEC)-specific NAIP–NLRC4 activity is sufficient to protect mice from shigellosis. In addition to describing a new mouse model of shigellosis, our results suggest that the lack of an inflammasome response in IECs may help explain the susceptibility of humans to shigellosis.

    1. Biochemistry and Chemical Biology
    2. Immunology and Inflammation

    The RNA helicase DDX39B activates FOXP3 RNA splicing to control T regulatory cell fate

    Minato Hirano, Gaddiel Galarza-Muñoz ... Mariano A Garcia-Blanco
    Research Article

    Genes associated with increased susceptibility to multiple sclerosis (MS) have been identified, but their functions are incompletely understood. One of these genes codes for the RNA helicase DExD/H-Box Polypeptide 39B (DDX39B), which shows genetic and functional epistasis with interleukin-7 receptor-α gene (IL7R) in MS-risk. Based on evolutionary and functional arguments, we postulated that DDX39B enhances immune tolerance thereby decreasing MS risk. Consistent with such a role we show that DDX39B controls the expression of many MS susceptibility genes and important immune-related genes. Among these we identified Forkhead Box P3 (FOXP3), which codes for the master transcriptional factor in CD4+/CD25+ T regulatory cells. DDX39B knockdown led to loss of immune-regulatory and gain of immune-effector expression signatures. Splicing of FOXP3 introns, which belong to a previously unrecognized type of introns with C-rich polypyrimidine tracts, was exquisitely sensitive to DDX39B levels. Given the importance of FOXP3 in autoimmunity, this work cements DDX39B as an important guardian of immune tolerance.

    1. Immunology and Inflammation

    Neuron-associated macrophage proliferation in the sensory ganglia is associated with peripheral nerve injury-induced neuropathic pain involving CX3CR1 signaling

    Rafaela Mano Guimarães, Conceição Elidianne Aníbal-Silva ... Thiago Mattar Cunha
    Research Article

    Resident macrophages are distributed across all tissues and are highly heterogeneous due to adaptation to different tissue-specific environments. The resident macrophages of the sensory ganglia (sensory neuron-associated macrophages, sNAMs) are in close contact with the cell body of primary sensory neurons and might play physiological and pathophysiological roles. After peripheral nerve injury, there is an increase in the population of macrophage in the sensory ganglia, which have been implicated in different conditions, including neuropathic pain development. However, it is still under debate whether macrophage accumulation in the sensory ganglia after peripheral nerve injury is due to the local proliferation of resident macrophages or a result of blood monocyte infiltration. Here, we confirmed that the number of macrophages increased in the sensory ganglia after the spared nerve injury (SNI) model in mice. Using different approaches, we found that the increase in the number of macrophages in the sensory ganglia after SNI is a consequence of the proliferation of resident CX3CR1+ macrophages, which participate in the development of neuropathic pain, but not due to infiltration of peripheral blood monocytes. These proliferating macrophages are the source of pro-inflammatory cytokines such as TNF and IL-1b. In addition, we found that CX3CR1 signaling is involved in the sNAMs proliferation and neuropathic pain development after peripheral nerve injury. In summary, these results indicated that peripheral nerve injury leads to sNAMs proliferation in the sensory ganglia in a CX3CR1-dependent manner accounting for neuropathic pain development. In conclusion, sNAMs proliferation could be modulated to change pathophysiological conditions such as chronic neuropathic pain.