Photoreceptor disc incisures form as an adaptive mechanism ensuring the completion of disc enclosure

  1. Tylor R Lewis  Is a corresponding author
  2. Sebastien Phan
  3. Carson M Castillo
  4. Keun-Young Kim
  5. Kelsey Coppenrath
  6. William Thomas
  7. Ying Hao
  8. Nikolai P Skiba
  9. Marko E Horb
  10. Mark H Ellisman
  11. Vadim Y Arshavsky  Is a corresponding author
  1. Department of Ophthalmology, Duke University Medical Center, United States
  2. National Center for Microscopy and Imaging Research, School of Medicine, University of California, San Diego, United States
  3. Eugene Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, United States
  4. Department of Pharmacology and Cancer Biology, Duke University Medical Center, United States

Abstract

The first steps of vision take place within a stack of tightly packed disc-shaped membranes, or ‘discs’, located in the outer segment compartment of photoreceptor cells. In rod photoreceptors, discs are enclosed inside the outer segment and contain deep indentations in their rims called ‘incisures’. The presence of incisures has been documented in a variety of species, yet their role remains elusive. In this study, we combined traditional electron microscopy with three-dimensional electron tomography to demonstrate that incisures are formed only after discs become completely enclosed. We also observed that, at the earliest stage of their formation, discs are not round as typically depicted but rather are highly irregular in shape and resemble expanding lamellipodia. Using genetically manipulated mice and frogs and measuring outer segment protein abundances by quantitative mass spectrometry, we further found that incisure size is determined by the molar ratio between peripherin-2, a disc rim protein critical for the process of disc enclosure, and rhodopsin, the major structural component of disc membranes. While a high perpherin-2 to rhodopsin ratio causes an increase in incisure size and structural complexity, a low ratio precludes incisure formation. Based on these data, we propose a model whereby normal rods express a modest excess of peripherin-2 over the amount required for complete disc enclosure in order to ensure that this important step of disc formation is accomplished. Once the disc is enclosed, the excess peripherin-2 incorporates into the rim to form an incisure.

Editor's evaluation

This study describes the importance of the stoichiometric relationship between rhodopsin and peripherin-2 in mouse rod outer segments. The authors use genetic manipulations to vary the ratio of these two proteins to demonstrate that excess peripherin leads to excess perimeter, which then leads to the infolded structures known as incisures. These data illustrate a fundamental principle that relates factors that control the area of a structure to factors that control the perimeter of a structure.

https://doi.org/10.7554/eLife.89160.sa0

Introduction

In the vertebrate retina, photoreceptor cells perform the first step of vision by capturing light and generating a neuronal signal. This process, called phototransduction, occurs within a stack of disc-shaped membranes, or ‘discs’, confined within the ciliary outer segment (see Figure 1A for a schematic representation). The outer segment undergoes continuous renewal whereby new discs are added at its base and old discs are phagocytosed from its tip by the apposing retinal pigment epithelium. New discs are formed as serial evaginations of the ciliary membrane, which eventually separate from the outer segment plasma membrane. This separation, known as disc enclosure, can be either complete in rods or partial in mammalian cones. The resulting mature disc contains a highly curved ‘rim’ supported by large oligomeric complexes of two tetraspanin proteins, peripherin-2 and ROM1 (see Spencer et al., 2020 for a recent review on disc morphogenesis).

Schematic illustration of incisure arrangements.

(A) Cartoon illustrating the structure of rod photoreceptors in mice and frogs. In each species, the outer segment contains hundreds of disc membranes in a stack. For simplicity, the connecting cilium and the axoneme are not shown. Of note, rod outer segments in frogs are much wider than in mice. (B) Cartoon illustrating two different types of incisure arrangements in a stack of rod discs. Incisures are indentations of the disc rim that are longitudinally aligned across the disc stack. Mouse discs have a single incisure, whereas frog discs have multiple incisures.

Early ultrastructural studies revealed that fully enclosed discs contain longitudinally aligned indentations of their rims, termed ‘incisures’ (Sjostrand, 1953; Cohen, 1960; Nilsson, 1965). Depending on the species, the number of incisures varies greatly: while mouse rods have only a single incisure (Cohen, 1960), frog rods have up to 20 (Nilsson, 1965). These incisure arrangements are illustrated in Figure 1B. Considering their functional role, it has been proposed that incisures can promote longitudinal diffusion of signaling molecules in the outer segment during the course of a light response (Ichikawa, 1996; Holcman and Korenbrot, 2004; Caruso et al., 2006; Bisegna et al., 2008; Gross et al., 2012; Makino et al., 2012; Caruso et al., 2020).

Little is known about the cellular and molecular mechanisms underlying the formation of incisures, including the relationship between the processes of disc enclosure and incisure formation. Work by Steinberg and colleagues (Steinberg et al., 1980) has suggested that incisure formation is not dependent on disc enclosure, based on the occasional observation of small discontinuities in the newly forming ‘open’ discs at the base of the outer segment. Yet, these discontinuities were not aligned longitudinally, suggesting that they may not have been incisures. In this study, we investigated the spatiotemporal relationship between disc enclosure and incisure formation by combining traditional transmission electron microscopy (TEM) with 3D electron tomography, which provides a high-resolution reconstruction of the entire outer segment base where new discs are formed. This analysis revealed that incisures are formed immediately after discs are fully enclosed. Additionally, we observed that, as new discs evaginate from the ciliary membrane, they are not round as typically depicted but rather are highly irregular in shape and resemble expanding lamellipodia of motile cells.

Considering the molecular mechanism of incisure formation, it has been shown that variations in the expression level of rhodopsin, the predominant protein constituent of disc membranes, can influence incisure size. While incisures of WT mice extend approximately halfway into the disc, the incisures of rhodopsin hemizygous mice extend nearly the entire disc diameter (Makino et al., 2012; Price et al., 2012). In contrast, transgenic overexpression of rhodopsin reduces incisure length or precludes incisure formation (Wen et al., 2009; Price et al., 2012). Another parameter controlled by rhodopsin expression level is disc diameter, which is decreased by a reduction in rhodopsin expression (Liang et al., 2004; Makino et al., 2012; Price et al., 2012) and increased by rhodopsin overexpression (Wen et al., 2009; Price et al., 2012). Together, these observations led Makino and colleagues to hypothesize that each disc has a set number of molecules responsible for the formation of its rim; smaller discs containing less rhodopsin direct more of these molecules to incisures, whereas larger discs require them to be incorporated along their circumference (Makino et al., 2012).

The two proteins most critical for disc rim formation are the homologous tetraspanins, peripherin-2 and ROM1, which form very large oligomeric structures fortifying the entire disc rim (Stuck et al., 2016; Pöge et al., 2021). The knockout of peripherin-2 (but not ROM1) completely precludes disc formation (Cohen, 1983; Jansen and Sanyal, 1984; Clarke et al., 2000), while transgenic overexpression of some peripherin-2 mutants in frogs can disrupt incisure structure (Tam et al., 2004; Milstein et al., 2020). This makes peripherin-2 the prime candidate for being the limiting disc rim component postulated in Makino et al., 2012. Therefore, we explored the role of peripherin-2 in incisure formation in the current study. We analyzed outer segments of genetically modified mice and frogs, in which the relative outer segment content of peripherin-2 was either reduced or increased. We found that a high level of peripherin-2 causes an increase in incisure size and structural complexity, while a low level precludes incisure formation.

Taken together, our findings suggest that rods express a modest excess of peripherin-2 over the amount needed for completing disc enclosure. Once enclosure is finished, an excess pool of peripherin-2 remaining in the disc incorporates into the rim to form an incisure.

Results

Incisure formation follows the completion of disc enclosure

We first sought to determine the spatiotemporal relationship between incisure formation and enclosure in newly forming discs. Our initial approach was to use traditional TEM to image longitudinally sectioned mouse rod outer segments that had been contrasted with a combination of tannic acid and uranyl acetate. This contrasting technique (Ding et al., 2015) allows for the discrimination between newly forming ‘open’ discs that are stained darker than fully enclosed discs. Several examples shown in Figure 2 reveal that incisures are never found in the newly forming, open discs at the base of the outer segment, but become evident as soon as discs become enclosed. These observations suggest that incisure formation is a process that only occurs after complete disc enclosure.

Incisures are observed only in fully enclosed discs of mouse rods.

(A–G) Representative TEM images of longitudinally sectioned WT mouse rods contrasted with a combination of tannic acid and uranyl acetate, which stains newly forming ‘open’ discs more intensely than mature enclosed discs. Yellow arrows point to darkly stained, unenclosed discs; yellow arrowheads point to longitudinally aligned incisures. Scale bars: 1 µm.

To fully appreciate the architecture of disc incisures, we conducted electron tomography, which provides a three-dimensional reconstruction of a sample with a resolution of ~1–3 nm in each dimension. Since we were interested in examining the status of disc enclosure and incisure formation in multiple discs at the outer segment base, we utilized a variation of this technique called scanning transmission electron microscopy (STEM) tomography, which allows for the imaging of thicker sections than other electron tomography approaches.

Using STEM tomography, we imaged ~750 nm plastic sections of mouse retinas cut tangentially at the region containing the interface between photoreceptor inner and outer segments. A representative example of a 3D reconstruction of such a section imaged at low magnification is shown in Figure 3—video 1 and an individual 3 nm z-section from this tomogram is shown in Figure 3. Because the bases of outer segments from individual photoreceptors are not precisely aligned in the retina, individual cells are sectioned across either inner or outer segments or their junctions. Notably, discernable incisures were observed in outer segments sectioned in the plane of mature, enclosed discs. To better appreciate the appearance of incisures, we pseudo-colored the surfaces of enclosed discs in Figure 3. To assess the stage of disc formation at which incisures are formed, we performed higher magnification tomography of individual rods whose outer segment base was in the section. Two major observations from these experiments can be appreciated from the examples shown in Figure 4 and Figure 4—videos 1–4, as follows:

First and consistent with TEM data, no incisures were observed in the newly forming discs. Second, the newly forming discs are surprisingly lamellipodia-like in shape. While traditionally illustrated as round evaginations of the ciliary plasma membrane (such as in Steinberg et al., 1980 or Spencer et al., 2020), the newly forming discs are actually irregular in shape, oftentimes with multiple protrusions. This observation, best appreciated in the individual z-sections shown in the left panels of Figure 4, is consistent with the notion that new discs are formed in a process akin to lamellipodia formation mediated by polymerization of a branched actin network (Spencer et al., 2019).

Figure 3 with 1 supplement see all
Representative z-section from a STEM tomogram of a 750-nm-thick tangential section of a WT mouse retina.

The retina was contrasted with tannic acid/uranyl acetate. Full tomogram is shown in Figure 3—video 1. Because individual rods in the mouse retina are not perfectly aligned, adjacent cells are sectioned at different compartments, including the inner segment (1), outer segment base (2) and mature outer segment (3). Shown on the right is an example of a longitudinally sectioned rod, in which these three locations are depicted by dashed lines. Surfaces of fully enclosed discs are pseudo-colored in magenta to highlight the structure of incisures. Yellow arrowhead points to an incisure in a fully enclosed disc. Tomogram pixel size is 3 nm; scale bars: 2.5 µm (left) or 0.5 µm (right).

Figure 4 with 4 supplements see all
Disc incisures are observed in mature but not newly forming discs.

(A) Representative z-sections at the depths of 0 (left),+168 (middle) and +244 nm (right) from a reconstructed electron tomogram of a 750 nm-thick WT mouse retinal section. Full tomogram is shown in Figure 4—video 1. To guide the reader, the surfaces of newly forming discs are pseudo-colored in orange and a mature disc in magenta. Pseudo-coloring was used only in this example as it masks some fine morphological features of the images. (B) Representative z-sections at the depths of 0 (left),+107 (middle) and +343 nm (right) from the reconstructed electron tomogram shown in Figure 4—video 2. (C) Representative z-sections at the depths of 0 (left),+65 (middle) and +186 nm (right) from the reconstructed electron tomogram shown in Figure 4—video 3. (D) Representative z-sections at the depths of 0 (left),+19 (middle) and +208 nm from the reconstructed electron tomogram shown in Figure 4—video 4. Yellow asterisks indicate the ciliary axoneme; yellow arrows point to newly forming, unenclosed discs; yellow arrowheads point to incisures in fully enclosed discs. Tomogram pixel size is 4.2 nm (A) or 2.1 nm (B–D); scale bar: 0.5 µm.

Another interesting observation from these tomograms is that incisures always originate from a spot adjacent to the ciliary axoneme. The axoneme itself, being perfectly cylindrical when it emanates from the basal body (Video 1), adopts a triangular shape at the spot where incisures are first formed (Figure 4 and Figure 4—videos 1–4). Comparable observations have been previously reported for a variety of species (e.g. Cohen, 1960; Young, 1971; Steinberg and Wood, 1975; Wen et al., 1982; Roof et al., 1991; Eckmiller, 2000). This suggests that microtubules of the ciliary axoneme establish the initial orientation of incisures, although it is unclear whether the transition in axonemal shape may be a part of the mechanism or a consequence of incisure formation.

Video 1
Reconstructed tomogram of a basal body nucleating the ciliary axoneme.

Shown is a 420 nm fragment of a 750-nm-thick retinal section. Tomogram pixel size is 0.7 nm. Field of view: 0.80 µm x 0.80 µm.

In another experiment, we performed high-magnification STEM tomography on a part of an outer segment containing mature discs with fully formed incisures (Figure 5A and Figure 5—video 1). We observed several structural elements (Figure 5B), including some that appeared to emanate from a microtubule of the ciliary axoneme and connect to the disc rim at the origin point of an incisure. The regulation of the spacing between discs has been proposed to involve microtubules (Gilliam et al., 2012), suggesting that the physical connections that we observed between microtubules and the disc rim could be involved in this process. We also observed structures that appear to connect the two apposing sides of an incisure, which are comparable to structures previously observed in toads (Roof and Heuser, 1982). Lastly, we frequently observed electron-dense structures at the incisure ends. Highlighting the power of STEM tomography, we were able to resolve incisures across a span of over 20 discs (Figure 5C and Figure 5—video 1). Despite always originating from the ciliary axoneme, incisures in adjacent discs were not well-aligned along their entire lengths.

Figure 5 with 1 supplement see all
Ultrastructure of mature disc incisures.

(A) Representative z-section from a reconstructed electron tomogram of a 750-nm-thick WT mouse retinal section. Full tomogram of the boxed area is shown in Figure 5—video 1. (B) Representative maximum intensity projections of 3 (left) or 4 (right) z-sections highlighting various structures observed in a mature incisure. Green arrows point to structures spanning between microtubules and the disc rim; purple arrows point to connectors between apposing sides of the incisure; blue arrow points to the electron-dense structure at the incisure end. Yellow asterisk indicates the microtubule adjacent to the incisure. (C) Representative z-sections at the depths of 0 (Disc 1),+31.5 (Disc 2) and +63 nm (Disc 3) illustrating an imperfect alignment of incisures in three adjacent discs. Yellow arrowheads point to the incisure end in Disc 1 and the same x,y-coordinates in subsequent discs. Tomogram pixel size is 2.1 nm; scale bars: 0.25 µm (A, C) or 25 nm (B).

Incisure size and shape are determined by the relative outer segment contents of peripherin-2 and rhodopsin

In the second part of this study, we explored the role of peripherin-2 in incisure formation. As described above, peripherin-2 plays an essential role in the formation of disc rims and transgenic overexpression of some peripherin-2 mutants in frogs disrupts the structure of incisures. The role of peripherin-2 in incisure formation should be considered in the context of its relative abundance with rhodopsin. Whereas rhodopsin serves as an essential structural element of the disc lamella, peripherin-2 (along with its homologous partner ROM1) form the disc rim. Together, rhodopsin and peripherin-2/ROM1 comprise ~99% of the total transmembrane protein material in normal discs (Skiba et al., 2023). Therefore, we sought to investigate whether the relationship between the surface area of a disc and the length of its rim, including both circumference and incisure, is determined by the molar ratio between rhodopsin and peripherin-2/ROM1.

The knockout of peripherin-2 (which occurs in homozygous rds mice Connell et al., 1991; Travis et al., 1991) is not a useful model to study incisure formation because it completely abolishes outer segment morphogenesis (Cohen, 1983; Jansen and Sanyal, 1984). However, outer segments are still formed in heterozygous rds (rds/+) mice despite a reduction in the level of peripherin-2 (Hawkins et al., 1985; Cheng et al., 1997). Whereas some of these outer segments are dysmorphic due to abnormal disc outgrowths (Figure 6—figure supplement 1), others retain their cylindrical shape, at least in young mice. We analyzed the ultrastructure of these relatively normal rds/+ outer segments in tangential sections using TEM and found a near complete ablation of incisure formation in their discs (Figure 6A). In fact, short incisures were present in only two out of 75 analyzed rds/+ discs, whereas in WT discs, incisures spanned ~50% of the disc diameter in all analyzed outer segments (Figure 6B). These observations suggest that a decrease in relative peripherin-2 content in discs suppresses incisure formation.

Figure 6 with 1 supplement see all
Reduction in peripherin-2 level prevents incisure formation in mouse rods.

(A) Representative TEM images of tangentially sectioned WT outer segments and rds/+ outer segments preserving their cylindrical shape. Yellow asterisks indicate the ciliary axoneme; yellow arrowheads point to incisures in WT discs. Scale bar: 1 µm. (B) Quantification of incisure length as a percent of the total disc diameter. Each data point represents a single outer segment. For each genotype, three mice were analyzed (labeled as 1, 2, and 3), with 25 outer segments analyzed in each mouse. Only 2 out of 75 analyzed rds/+ rods contained discernible incisures. Error bars represent mean ± s.d.

We next analyzed hemizygous rhodopsin (Rho+/-) mice, in which the molar fraction of peripherin-2 in discs is increased due to a reduction in rhodopsin expression. Rho+/- outer segments were previously shown to lack major morphological abnormalities apart from a reduced disc diameter ( +/-), increased incisure length Makino et al., 2012; Price et al., 2012 and somewhat reduced outer segment length (Liang et al., 2004; Price et al., 2012; see also Figure 6—figure supplement 1). Interestingly, we found that disc incisures in these mice were not just longer but also had significant variability in shape. Some of them were mostly straight, as in WT mice, but extended the entire disc diameter (Figure 7A). Others were bifurcated or twisted along their length (Figure 7B). A subset of outer segments contained tubular structures aligned along the incisure (Figure 7C), which are strikingly similar to structures observed in rhodopsin knockout (Rho-/-) mice (Figure 7D) thought to be formed by peripherin-2 in the absence of normal disc formation (Chakraborty et al., 2014). They are also similar to the tubular structures forming in cultured cells expressing recombinant peripherin-2 (Milstein et al., 2017; Salinas et al., 2017; Milstein et al., 2020). Therefore, the tubules observed in some Rho+/- outer segments are likely to be formed by the excess of peripherin-2 not incorporated into the incisure. These observations suggest that an increase in relative peripherin-2 content in discs causes an increase in incisure size and complexity.

Increase in relative peripherin-2 level produces long incisures of varying shape.

(A–C) Representative TEM images of tangentially sectioned Rho+/- mouse retinas. Incisures can be relatively straight and extend nearly the entire disc diameter (A) or be bifurcated or twisted (B). In some cells, incisures are associated with tubular structures (C). (D) Representative TEM image of a tangentially sectioned Rho-/- retina. While lacking discs, the outer segment cilium contains a large number of tubular structures. Yellow arrowheads point to incisure ends; orange arrows point to tubular structures. Scale bar: +/- µm.

To further explore the idea that the sizes of discs and incisures are defined by the molar ratio between rhodopsin and peripherin-2, we measured this ratio in outer segments obtained from mice of all three genotypes. We also analyzed the levels of ROM1 because it is another tetraspanin contributing to disc rim formation by oligomerizing with peripherin-2. We used a quantitative mass spectrometry approach that we have recently applied to determine the molar ratio amongst multiple outer segment proteins, including these three proteins (Skiba et al., 2023). Our measurements are summarized in Table 1 (see for raw data).

Table 1
Quantification of molar ratios between rhodopsin, peripherin-2 and ROM1 in mouse outer segments.
Protein molar ratio*WTrds/+Rho+/-
Rhodopsin: peripherin-218.2±0.630.9±6.08.5±1.5
Rhodopsin: ROM142.2±0.629.9±2.021.6±3.7
Peripherin-2: ROM12.3±0.11.0±0.22.6±0.6
Rhodopsin: (Peripherin-2 +ROM1)12.7±0.415.1±1.86.0±0.8
  1. *

    Values are shown as mean ± s.d. Three outer segment preparations from mice of each genotype were analyzed.

Table 1—source data 1

Quantification of molar ratios between rhodopsin, peripherin-2 and ROM1 in mouse outer segments – raw data.

https://cdn.elifesciences.org/articles/89160/elife-89160-table1-data1-v2.xlsx

In WT outer segments, the molar ratios of rhodopsin to peripherin-2 and ROM1 were ~18:1 and ~42:1, respectively, as in Skiba et al., 2023. In rds/+ outer segments, the rhodopsin to peripherin-2 ratio was increased by ~1.7 fold (~31:1), whereas in Rho+/- outer segments it was decreased by +/-2 fold (~9:1). Both changes are consistent with these mouse lines expressing single copies of the corresponding gene (see also Lem et al., 1999; Chakraborty et al., 2014). Considering ROM1, rds/+ outer segments contained relatively more ROM1 than WT outer segments (rhodopsin to ROM1 ratios of ~30:1 and ~42:1, respectively), suggesting that more ROM1 is incorporated into disc rims when there is a deficiency in peripherin-2. Accordingly, the molar ratio between peripherin-2 and ROM1 shifted from ~2.3:1 in WT rods to ~1:1 in rds/+ rods. In contrast, the molar ratio between peripherin-2 and ROM1 was essentially unaffected in Rho+/- +/- (~2.6:1 vs. ~2.3:1 in WT rods), indicating that rhodopsin deficiency does not disrupt the balance between these two tetraspanins.

Overall, the molar ratio between rhodopsin and total tetraspanin protein (peripherin-2 and ROM1 combined) changed from ~13:1 in WT rods to ~15:1 in rds/+ rods and~6:1 in Rho+/- +/-. These measurements are consistent with our qualitative conclusions from the ultrastructural analysis of these mice and suggest that these conclusions apply to both ratios of rhodopsin to peripherin-2 and the total tetraspanin content.

In the case of Rho+/- +/- whose entire outer segment population is devoid of major morphological defects, we sought to determine whether the measured increase in relative tetraspanin abundance could explain the observed increase in the size and complexity of incisures. We calculated the theoretical incisure length in Rho+/- +/- based on the assumptions that the disc surface area is proportional to the number of rhodopsin molecules, whereas the entire length of the disc rim (including both the circumference and incisure) is proportional to the number of tetraspanin molecules. Unfortunately, rds/+ mice could not be analyzed this way because the majority of their outer segments did not produce proper discs (Figure 6—figure supplement 1).

We measured disc diameters in WT and Rho+/- +/- to be ~1.5 and~1.1 µm, respectively (Figure 8), which is consistent with previous reports (Liang et al., 2004; Makino et al., 2012; Price et al., 2012; Lewis et al., 2020). These values correspond to disc surface areas of 3.53 and 1.80 µm2, respectively (see Table 2 for all values calculated in this analysis). We next estimated the number of rhodopsin and tetraspanin molecules in a single disc of each genotype. Given that an average WT mouse rod contains ~60 million rhodopsin molecules (Lyubarsky et al., 2004; Nickell et al., 2007) and ~800 discs (Liang et al., 2004), there are ~75,000 rhodopsin molecules in each disc. Considering that rhodopsin packing density in disc membranes is unaffected by its expression level (Liang et al., 2004), we calculated that the number of rhodopsin molecules in Rho+/- +/- is~38,200, based on its surface area. Using our measured rhodopsin to tetraspanin ratios, we determined that the total number of tetraspanin molecules per disc in WT and Rho+/- +/- is similar and equal to ~5910 and~6360, respectively.

Quantification of disc diameters in WT and Rho+/- mouse rods.

Each data point represents a single outer segment. For each genotype, three mice were analyzed (labeled as 1, 2, and 3), with 25 outer segments analyzed in each mouse. Error bars represent mean ± s.d. Unpaired t-test was performed using the average disc diameter in each mouse to determine that the difference in diameters of WT and Rho+/- +/- was statistically significant (p=0.0075).

Table 2
Summary of quantitative parameters determined for mouse discs.
Calculated parameterWTRho+/-
Disc surface area (both lamellae)3.53 µm21.80 µm2
Rhodopsin molecules per disc75,00038,200
Peripherin-2+ROM1 molecules per disc5,9106,360
Total rim length6.21 µmN/A*
Measured incisure length as % of disc diameter50%N/A*
Theoretical incisure length as % of disc diameter-155%
  1. *

    Incisure and total rim lengths in Rho +/- discs cannot be readily measured due to incisure complexity.

  2. The value is taken from the measurements shown in Figure 6.

Next, we measured the total disc rim length in WT discs, including the incisure, and found it to be 6.21 µm. Assuming that all tetraspanin molecules in fully enclosed discs are located at the rims, we estimated that there are ~950 tetraspanin molecules per 1 µm of disc rim in WT rods. Assuming that this tetraspanin density is not changed in disc rims of Rho+/- +/-, we calculated that the total rim length in Rho+/- +/- is predicted to be ~6.69 µm. Given that the circumference of Rho+/- +/- is~3.36 µm, the predicted incisure length is ~1.66 µm, or ~155% of the disc diameter. The fact that this value exceeds 100% is consistent with the observed abnormalities in incisure length and shape, including bifurcated or twisted incisures and adjacent tubular structures. Of note, the outer segment length does not affect this analysis because the molar ratio between rhodopsin and tetraspanins in each disc is invariant across the entire disc stack.

Peripherin-2 knockout frogs form outer segments with greatly reduced incisures

In the last set of experiments, we explored the role of peripherin-2 in controlling incisure formation in frog photoreceptors, as their discs contain more than a single incisure (Figure 1). We generated a peripherin-2 knockout (prph2-/-) Xenopus tropicalis frog using CRISPR-Cas9 to create mutations within exon 1 of prph2 (see Materials and methods for additional details). Ultrastructural analysis of their retinas revealed a relatively normal outer segment morphology, except for occasional overgrowth of disc membranes sometimes shaped as whorls (Figure 9).

Figure 9 with 1 supplement see all
Loss of peripherin-2 in frogs (Xenopus tropicalis) prevents incisure formation.

(A–D) Representative TEM images of longitudinally sectioned WT and prph2-/- frog retinas. (E,F) Representative TEM images of tangentially sectioned WT and prph2-/- frog retinas. Magenta arrows point to defects in outer segment morphology; yellow arrowheads point to incisures; asterisks indicate cones, as evident by the presence of an oil droplet in their inner segments. OS: outer segment; IS: inner segment. Scale bars: 5 µm.

The formation of outer segments in these frogs was surprising considering the complete lack of outer segments in peripherin-2 knockout mice. This cross-species difference could be explained by Xenopus expressing multiple peripherin-2 homologs. It was reported that Xenopus laevis expresses three peripherin-2 homologs termed xrds38, xrds36, and xrds35 (Kedzierski et al., 1996). The current annotations of the Xenopus tropicalis and Xenopus laevis genomes suggest that xrds38 (knocked out in our current study) is the frog peripherin-2 homolog (XenBase: XB-GENEPAGE-985593) while xrds36 and xrds35 are isoforms of ROM1 (XenBase: XB-GENEPAGE-962405). In addition, these genomes contain another peripherin-2-like gene, termed prph2l (XenBase: XB-GENEPAGE-5759091). Therefore, it is plausible that peripherin-2-like protein and/or ROM1 isoforms are sufficient or even play a primary role in supporting outer segment morphogenesis in frog photoreceptors.

As previously shown, discs of WT frogs contained numerous incisures (Figure 9). Like in mice, one of these incisures was aligned with the ciliary axoneme (Figure 9—figure supplement 1). In contrast, rods of prph2-/- frogs displayed a nearly complete lack of incisures (Figure 9), apart from rare examples of discs containing a single incisure (Figure 9F). This phenotype resembles that of rds/+ mice and shows that peripherin-2 is an important contributor to the formation of the entire disc rim structure in frogs that cannot be fully replaced by other homologous tetraspanins expressed in these cells.

Discussion

In this study, we explored the mechanisms underlying the formation of disc incisures in rod photoreceptors and report two central findings. First, we found that incisures are formed only after the completion of disc enclosure. Notably, this is contrary to the conclusion in the classical paper by Steinberg and colleagues which first described the currently accepted mechanism of disc morphogenesis (Steinberg et al., 1980). The authors concluded that “incisure formation occurs … before rim formation is complete around the entire perimeter of the disc … Closure of the disc, therefore, is not a prerequisite for incisure formation”. However, the structures in nascent discs that were interpreted as incisures in Figure 11 of Steinberg et al., 1980 were not aligned longitudinally, which is a hallmark property of incisures. Such a lack of alignment suggests an alternative explanation for the small discontinuities of disc membranes that they interpreted as incisures. These discontinuities could be explained by a thin plastic section being cut through an uneven edge of an expanding disc, which created an appearance of a gap between the most expanded portions of the disc lamella. How uneven nascent disc expansions can be prior to assuming their final round shape is well-illustrated in the 3D tomograms presented in our study. A related argument was made in another study employing 3D tomography (Volland et al., 2015), which illustrated that, when analyzed in thin sections, enclosing discs may artificially appear as intracellular vesicles.

It is generally accepted that the formation of incisures is limited to rods (Goldberg et al., 2016). This could be appreciated in Figure 9A showing two cones lacking incisures alongside rods having multiple incisures in a WT frog retina. Because mature cone discs do not enclose or enclose partially in mammals, the lack of cone incisures is consistent with our conclusion that incisure formation takes place after disc enclosure. However, we must note that there have been a few reports of mammalian cones with a single incisure (Steinberg and Wood, 1975; Anderson and Fisher, 1979; Carter-Dawson and LaVail, 1979), which warrants further investigation into the status of disc enclosure and the presence of incisures in mammalian cones.

Our second central finding is that incisure size and complexity are dependent on the relative outer segment contents of rhodopsin and peripherin-2. An excess of peripherin-2 leads to longer, more complex incisures, whereas a deficiency precludes incisure formation along with an occasional inability of discs to enclose. Less clear is the exact contribution of ROM1 to these processes. In the case of rds/+ mice, characterized by a rather severe defect in outer segment morphogenesis, the ratio of rhodopsin to total tetraspanin protein in disc membranes decreases only modestly compared to WT mice (~15:1 vs. ~13:1) due to an increase in ROM1 content. It is intriguing to speculate that the gross morphological defects of rds/+ discs may not be caused by this modest reduction in total tetraspanin content, but rather by the nearly 2-fold reduction in the relative peripherin-2 content. This would argue that ROM1 is unable to efficiently compensate for a deficiency in peripherin-2. Consistent with this line of thought, Rom1-/- outer segments have relatively minor morphological defects (Clarke et al., 2000) despite ROM1 accounting for ~30% of the total tetraspanin content of the outer segment. The specific role of ROM1 in supporting disc structure remains to be determined in future experiments.

Taken together, these findings led us to propose that rod photoreceptors have evolved to express a slight excess of peripherin-2 over the amount needed to fully enclose their discs. Ensuring full enclosure is important because defects in this process lead to uncontrolled disc membrane outgrowth and ultimate photoreceptor cell death. Such a pathology is observed in photoreceptors with a reduced molar ratio of peripherin-2 to rhodopsin, such as in rds/+ mice (Hawkins et al., 1985; Sanyal et al., 1986; Sanyal and Hawkins, 1986) and in mice overexpressing rhodopsin (Price et al., 2012). The same pathology is caused by mutations in peripherin-2 that affect its oligomerization (Stuck et al., 2014; Zulliger et al., 2018; Conley et al., 2019; Milstein et al., 2020; Lewis et al., 2021). Unlike peripherin-2 deficiency, an excess of peripherin-2 does not lead to severe morphological outer segment defects, such as in Rho+/- +/- or mice overexpressing peripherin-2 (Nour et al., 2004). These differences could be appreciated in the side-by-side comparison of rds/+ and Rho+/- outer segments in +/-. Therefore, the fact that rods express a slight excess of peripherin-2 over the amount required for disc enclosure may be viewed as an evolutionary adaptation to prevent severe pathology arising from incomplete disc enclosure. Following the completion of disc enclosure, this excess of peripherin-2 is deposited in the form of an incisure, which may serve to protect the flat lamellar disc membranes from undesirable deformations.

A second, not mutually exclusive function of incisures that has been long-discussed in the literature is to promote longitudinal diffusion of signaling molecules, such as cGMP and Ca2+, in the outer segment (Ichikawa, 1996; Holcman and Korenbrot, 2004; Caruso et al., 2006; Bisegna et al., 2008; Gross et al., 2012; Makino et al., 2012; Caruso et al., 2020). This may increase the sensitivity and uniformity of light responses, particularly those evoked by a small number of photons. Theoretical analysis shows that this mechanism is particularly relevant in wider rods containing multiple incisures, but may be less significant in thin rods containing a single incisure, such as in the mouse (Caruso et al., 2006; Caruso et al., 2020). These conclusions remain to be tested in physiologically intact photoreceptors.

Another unanswered question is how the number of incisures in a disc is determined. While mouse rods have a single incisure, amphibian rods may have over 20. It is unlikely that incisure number is regulated merely by the relative tetraspanin content, as we typically observed elongated incisures rather than multiple incisures in Rho+/- +/-. It is likely that incisure number is regulated by the abundance of outer segment microtubular structures. In fact, the presence of non-axonemal microtubules aligned with incisures was documented in frog rods (Eckmiller, 2000). The goal of future studies is to elucidate the specific role of microtubules in controlling incisure formation and number.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
strain, strain background (Mus musculus)C57BL/6 JJackson LabsJax#:000664
genetic reagent (Mus musculus)RhoLem et al., 1999MGI:2680822
genetic reagent (Mus musculus)rdsvan Nie et al., 1978MGI:1856523
strain, strain background (Xenopus tropicalis)NigerianNational Xenopus ResourceRRID:NXR_1018
genetic reagent (Xenopus tropicalis)prph2This paperRRID:NXR_3003National Xenopus Resource

Animal husbandry

Request a detailed protocol

Animal maintenance and experiments were approved by the Institutional Animal Care and Use Committees at Duke (Durham, NC; protocol #A184-22-10) and the Marine Biological Laboratory (Woods Hole, MA; protocol #22–29). WT mice (Mus musculus) were C57BL/6 J (Jackson Labs stock #000664). rds mice are described in van Nie et al., 1978. Rho-/- mice are described in Lem et al., 1999. Mice were genotyped to ensure that they did not contain either the rd8 (Mattapallil et al., 2012) or rd1 (Pittler et al., 1993) mutations commonly found in inbred mouse strains. prph2 mutant frogs (Xenopus tropicalis) are described below. Mice were used at 1 month of age. Frogs were used at either 7- or 14 days post fertilization. All experiments were performed with animals of randomized sex and, for each experiment, at least three biological replicates were analyzed.

Generation of prph2 knockout Xenopus tropicalis

Request a detailed protocol

The prph2 knockout line (RRID:NXR_3003) was generated using CRISPR-Cas9. CRISPRScan Moreno-Mateos et al., 2015 was used to design two sgRNAs within the first exon of prph2 (sgRNA1: GGGGTCTGCTTCTTGGCCAG; sgRNA2: GGGATACTGACACCCCCGGC) with 5’ dinucleotides converted to GG for increased mutagenic activity (Gagnon et al., 2014). sgRNAs were synthesized using the SP6 MEGAscript SP6 Transcription Kit (Invitrogen, Waltham, MA). F0 injections were performed by injecting one-cell stage embryos from the X. tropicalis Nigerian strain (RRID: NXR_1018). Each embryo was injected with 500 pg each of sgRNA1/sgRNA3 and 1000 pg Cas9. Founders were raised to sexual maturity and screened for germline transmission of mutations. A –20 bp mutation, which results in a frameshift mutation at amino acid 183 and a stop codon 7 amino acids downstream, was selected for generating the prph2 line. Intercrosses were done on –20 bp heterozygotes to generate prph2 mutants.

Tissue fixation

Request a detailed protocol

For mice, tissue fixation was performed as described previously (Ding et al., 2015). In the morning after lights were turned on, anesthetized mice were transcardially perfused with 2% paraformaldehyde, 2% glutaraldehyde and 0.05% calcium chloride in 50 mM MOPS (pH 7.4) resulting in exsanguination. Enucleated eyes were fixed for an additional 2 hr in the same fixation solution at room temperature prior to processing. For frog tadpoles, tissues were fixed with 2% paraformaldehyde, 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2) overnight at 4 °C.

Tissue processing

Request a detailed protocol

For processing of longitudinal sections of mouse retinas, eyecups were dissected from fixed eyes, embedded in 2.5% low-melt agarose (Precisionary, Greenville, NC) and cut into 200-µm-thick slices on a Vibratome (VT1200S; Leica, Buffalo Grove, IL). Agarose sections were treated with 1% tannic acid (Electron Microscopy Sciences, Hartfield, PA) and 1% uranyl acetate (Electron Microscopy Sciences), gradually dehydrated with ethanol and infiltrated and embedded in Spurr’s resin (Electron Microscopy Sciences). For processing of tangential sections of mouse retinas, dissected retinas were treated with 1% tannic acid (Electron Microscopy Sciences) and 1% uranyl acetate (Electron Microscopy Sciences), gradually dehydrated with ethanol and infiltrated and embedded in Spurr’s resin (Electron Microscopy Sciences). For processing of frog samples, tadpoles were treated with 1% tannic acid (Electron Microscopy Sciences) and 1% uranyl acetate (Electron Microscopy Sciences), gradually dehydrated with ethanol and infiltrated and embedded in Spurr’s resin (Electron Microscopy Sciences).

Transmission electron microscopy

Request a detailed protocol

A total of 70 nm sections were cut from resin-embedded samples, placed on copper grids and counterstained with 2% uranyl acetate and 3.5% lead citrate (Ted Pella, Redding, CA). Samples were imaged on a JEM-1400 electron microscope (JEOL, Peabody, MA) at 60 kV with a digital camera (BioSprint; AMT, Woburn, MA). Image analysis and processing was performed with ImageJ.

Electron tomography

Request a detailed protocol

Of the central retina, 750 nm sections were cut from resin-embedded samples and placed on 50 nm Luxel film slot grids. The grids were glow-discharged on both sides, and a mixture of 10 nm, 20 nm, and 60 nm gold particles were deposited on the sample surfaces to serve as fiducial markers. Electron tomography was conducted on a Titan Halo (FEI, Hillsboro, OR) operating at 300 kV in STEM mode. A 4-tilt series data acquisition scheme previously described (Phan et al., 2017) was followed in which the specimen was tilted from −60° to +60° every 0.25° at 4 evenly distributed azimuthal angle positions. The micrographs were collected with a high-angle annular dark field (HAADF) detector. The final volumes were generated using an iterative reconstruction procedure (Phan et al., 2017). Image analysis and processing was performed with 3dmod and ImageJ.

Quantitative mass spectrometry

Request a detailed protocol

A crude preparation of rod outer segments was obtained from dissected mouse retinas that had been vortexed in 8% OptiPrep in mouse Ringer’s solution (containing 130 mM NaCl, 3.6 mM KCl, 2.4 mM MgCl2, 1.2 mM CaCl2, and 10 mM HEPES, pH 7.4) that was adjusted to 314 mOsm. The preparation was briefly left on ice to allow the remaining retinal tissue to settle. The supernatant was removed and centrifuged at 20,000 x g. Pelleted outer segments were gently washed with mouse Ringer’s solution before lysis with 2% SDS in PBS. Protein concentration was measured with the Bio-Rad Protein Assay kit (Bio-Rad, Hercules, CA). Samples containing 20 µg of protein were mixed with 0.5 µg BSA (used as an internal standard in this analysis) and cleaved with 1 µg trypsin/LysC mix (Promega, Madison, WI) using the SP3 beads protocol described in Hughes et al., 2014. The combined digest of outer segments and BSA was mixed with the digest of a chimeric protein consisting of concatenated tryptic peptides of outer segment proteins, including rhodopsin, peripherin-2 and ROM1, which is described in Skiba et al., 2023. Mass spectrometry, data processing and data analysis were also performed as described in Skiba et al., 2023. For each genotype, a total of three biological replicates were analyzed.

Materials availability statement

Request a detailed protocol

The prph2 knockout frog (RRID:NXR_3003) is available at the National Xenopus Resource.

Data availability

All data generated or analyzed for this study are included in the manuscript and supporting files.

References

    1. Cohen AI
    (1983)
    Some cytological and initial biochemical observations on photoreceptors in retinas of rds mice
    Investigative Ophthalmology & Visual Science 24:832–843.
    1. Sanyal S
    2. Dees C
    3. Zeilmaker GH
    (1986)
    Development and degeneration of retina in rds mutant mice: observations in chimaeras of heterozygous mutant and normal genotype
    Journal of Embryology and Experimental Morphology 98:111–121.

Decision letter

  1. Audrey M Bernstein
    Reviewing Editor; State University of New York Upstate Medical University, United States
  2. Lois EH Smith
    Senior Editor; Boston Children's Hospital, United States
  3. James B Hurley
    Reviewer; University of Washington, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

https://doi.org/10.7554/eLife.89160.sa1

Author response

General Statements [optional]

We are very pleased that our manuscript was well-received by each of the three reviewers. Reviewer #1 found our study to be “interesting”, “clear” and “convincing”. Reviewer #2 found our study to be “unprecedented” and of “considerable interest to cell biologists in the vision community and likely to the broader cell biology community”. Reviewer #3 believed that we reported “novel and significant findings into an important cell biological problem” and that our study “should be of broad interest to cell biologists and vision scientists”. This reviewer also stated that “it is strongly recommended for publication”.

Point-by-point description of the revisions

Reviewer #1:

The paper of Lewis et al. presents an interesting study describing new information about the morphology of nascent discs and the role of peripherin in determining disc and incisure structure. I have only a few comments mostly about presentation.

We are happy that the reviewer liked our study.

1. Because this study employs both frog and mouse, the authors should be careful to give the species when describing their results. The naming of the species would be particularly important in the first paragraph of the Results section and the legend to the first data figure, Figure 2.

We have clarified the text and figure legends to allow the reader to better follow which species each result came from.

2. It is unclear what Movie 1 adds to Figure 3. This movie could perhaps be omitted.

We prefer to include the source data that the image in Figure 3 is derived from, particularly to stress that the pattern shown in a single z-section in this figure can be seen throughout the entire tomogram. We hope that the reviewer would agree.

3. Movies 3 and 5 either don't work or consist of single frames, which would be better illustrated as figures in the text rather than as supplementary movies.

We appreciate the reviewer catching that there were some technical issues with video playback. We have recompressed these videos and ensured that they will now play appropriately across a wide variety of computer specifications and video player applications.

4. The incisures in Figure 4 will be difficult for many readers to visualize. My experience was that once I saw one of them, I began to see the others. The incisures in Figure 5 are, on the other hand, very easy to see. If Figure 5 had come before Figure 4, I would have had no problem. The authors may wish to exchange these two figures or to supply a cartoon for one of the rods in Figure 4, so that the reader can more easily understand what he or she should be trying to see.

We thank the reviewer for pointing out that some readers may have difficulties in fully appreciating the structure of incisures in this figure. We made two changes to improve the presentation of these images. First, we pseudo-colored several examples of enclosed discs in Figure 3, which highlights the structure of incisures. We also indicated one example of an incisure in these images with an arrowhead. Second, we pseudo-colored the example shown in Figure 4A to illustrate the same point, while still allowing the reader to view the three remaining examples in Figure 4 without any overlaid modifications.

5. It is unclear to me why the authors are so fond of their untested theory that incisures "likely serve to protect the flat lamellar disc membranes from undesirable deformations" but seem skeptical of the notion that incisures are present and especially numerous in rods of large diameter to aid longitudinal diffusion. The later notion is supported not only by theoretical calculations but also by common sense.

We appreciate this comment and, in fact, feel agnostic about both of these not mutually exclusive ideas. We removed the statement that the deposition of peripherin-2 in incisures likely serves to protect the flat lamellar disc membranes from undesirable deformations from the Introduction and rephrased the text in Discussion to stress that both functions are plausible and not mutually exclusive.

This manuscript presents a clear and convincing description of disc formation and the role of the protein peripherin in the formation of disc incisures.

Thank you for your kind comment.

Reviewer #2:

Summary: The manuscript by Lewis et al. focuses on the potential mechanisms underlying formation of incisures in rod photoreceptors. Incisures refer to the indentations that occur on the rim of the photoreceptor disc membranes. The presence of incisures has been noted for decades and have been identified across a number of species. The role of incisures is not entirely clear and the mechanisms governing their formation have largely been inferred from early transmission electron microscopy studies 40-60 years ago. More recent ultrastructural studies of rod outer segment discs from mice carrying mutant alleles of rhodopsin or periperhin-2 described changes in the length or presence of incisures, suggesting that these proteins likely play a fundamental role in incisure formation in mouse. The authors take advantage of advances in electron tomography to provide unprecedented analyses of incisure formation, size, and structural complexity in stacked discs within mouse photoreceptors. They also use genetic models to explore how rhodopsin and peripherin-2 contribute to incisure formation and length. The authors find that new discs are highly irregular in shape and do not contain incisures during disc formation. Incisures are only formed are discs are enclosed. They find that the incisures in adjacent discs always align adjacent to the ciliary axoneme. Intriguingly, they find evidence of physical connections on opposing sides of the incisure. Critically, they find that elevated levels of peripherin-2 increase incisure size and complexity while low levels of peripherin-2 prevent incisure formation. In contrast, reduced molar ratios of rhodopsin lead to smaller disc surface area but increased incisure complexity. These results lead the authors to conclude that incisure formation is mechanistically linked to the relative molar ratio of peripherin-2 to rhodopsin and that rods make a slight excess of peripherin-2 in order to drive proper disc closure. The excess peripherin-2 within the disc rim forces formation of an incisure.

We are happy that the reviewer liked our study.

Major comments

1. Line 145-146: the location of the incisure adjacent to the ciliary axoneme is an interesting observation indeed. As frogs have a number of incisures, is this a similar observation in species with multiple incisures or more exclusive to those species with a single incisure?

Indeed, we did observe that one of the many incisures in a frog disc is aligned with the ciliary axoneme. We have now included Supplementary Figure S2 to highlight this observation using an example of two adjacent cells.

2. While the presence of non-axonemal microtubules aligned with incisures in frog rods may provide an explanation for the number of incisures, the correlation with peripherin and rhodopsin content was lacking. In other words, do frog rods have considerably more peripherin-2 per disc than mouse rods?

This is a great question and one that we are interested in pursuing in the future. However, adapting the mass spectrometry-based protein quantification approach that we used to determine the absolute numbers of peripherin-2, ROM1 and rhodopsin molecules per disc was a significant undertaking that took several years (Skiba et al., PMID: 36711880). This approach is currently applicable to only a particular set of outer segment proteins in the mouse and cannot be automatically re-purposed to quantification of proteins in other species that have different amino acid sequences. Thus, designing, validating and employing this quantification protocol to all peripherin-2 and ROM1 isoforms along with rhodopsin in the frog would be a major undertaking that cannot be completed in the context of this revision. Nonetheless, we are very appreciative for the reviewer’s enthusiasm for this topic and plan to address this question in the future.

Minor comments

1. The location of the incisures are difficult to see in Figure 4. The arrowhead is pointing to a very low contrast area of the disc and the thin incisure can be seen, but it's difficult. If it is possible to pseudocolor the image in some way to highlight the disc vs the extramembrane space, it would be helpful.

We thank the reviewer for noticing this issue, which was also commented by another reviewer. As described above, we pseudo-colored several examples in Figures 3 and 4.

2. Line 138-142: As with any descriptive narrative of cell structures, it is important to ensure the reader can fully understand and appreciate the interpretation of the authors. The shape of the newly forming discs can be difficult to appreciate in Figure 4. The authors are strongly encouraged to perhaps take 1-2 examples and provide a drawing or schematic of the image that can be more clearly annotated to assist readers in finding the outline of the discs and incisures.

We appreciate this point and pseudo-colored the surfaces of new forming discs in the examples shown in Figure 4A. We feel that pseudo-coloring helps the reader better visualize not only the structure of incisures, but also the irregular shape of the newly forming discs as in this specific example.

Overall, the paper is well-written and organized logically. The figures are generally easy to interpret although some additional annotations would help readers identify incisures in some low-contrast images (see comments). The authors utilized state-of-the-art electron tomographic data and mouse genetics to address a fundamental question. This will be of considerable interest to cell biologists in the vision community and likely to the broader cell biology community on how peripheral/rim proteins can shape membrane.

It is needless to say that we are very pleased by these comments and that the reviewer found our study to be of considerable interest to the broader cell biology community.

The authors provide a well-reasoned model for how incisures form in mouse rod photoreceptors: a relative excess of peripherin-2 drives incisure formation. This agrees with their mass-spectrometry data and molar ratios of peripherin-2 and rhodopsin. The main concern and outstanding question is whether these results are specific to mouse photoreceptors? The experiments in Xenopus were limited and only found that a CRISPR knockout of one peripherin-2 ortholog prevented incisure formation. While this result agreed with the general model and how molar ratios of peripherin-2 contribute, the knockout phenotypes are different than that of mouse. Some hypotheses are mentioned to explain this, but none were tested. The authors provide a model that agrees with mouse data, but is this generalizable? The model should permit several predictions for incisure formation beyond that of mouse rods. It would be most helpful to look in a species with multiple incisures and calculate the molar ratios of rhodopsin and peripherin-2. Do Xenopus require significantly more peripherin-2 to form multiple incisures? Alternatively, is it possible for the authors to mine publically available proteomics studies to assess rhodopsin and peripherin-2 content from other species (e.g. human, non-human primates, rats, etc…) and correlate to incisure number and/or length? The study overall is interesting and thought-provoking, but the overall impact would be greatly enhanced if additional evidence was provided that their model is broadly generalizable given the variety in incisure number and photoreceptor disc morphology (e.g. surface area, diameter) across species.

Related to a comment above, we are interested in pursuing each of these directions in frogs and other species in future studies, although it is not feasible to accomplish the required body of work in the context of manuscript revision. There are three other photoreceptor tetraspanins homologous to peripherin-2 that remain to be quantified and knocked out in frogs, alone and in combinations (the xrds36 and xrds35 isoforms and the peripherin-2-like protein). Testing the function of each of these in incisure formation would be an endeavor spanning several years of work. Additionally, there are no publicly available proteomic datasets that would contain information allowing an accurate quantification of rhodopsin and these homologous tetraspanins in other species. This question would require us to adapt our protein quantification approach, which would indeed be valuable, but would take significant time to complete.

Reviewer #3:

Summary. This work explores the formation of incisures in rod outer-segment (OS) disks. The visual pigment rhodopsin is the major lamellar protein in rod OS disks, while peripherin is the major structural protein of the disk rim. The authors used wild-type, Rho+/- and Rds+/- mice to vary the ratio of rhodopsin to peripherin in vivo, and compared these ratios to incisure length and complexity in rod OS.

Comments. This study presents several new findings. The authors convincingly show by EM tomography that incisures only form after each OS disk has reached maturity (fully separated from the plasma membrane). This new finding corrects an earlier published observation. Next, they examined disk morphology in Rds+/- heterozygous null-mutant mice and showed that an ~50% reduction in peripherin levels resulted in rod OS disks with no incisures. They performed a similar study on Rho+/- heterozygotes mutants. This time they observed that an ~50% reduction in rhodopsin levels resulted in OS disks with excessively long incisures. MS analysis of rod OS proteins and quantitative analysis of the EM images showed that incisure length varies with the ratio of peripherin to rhodopsin. They further showed that wild-type rods contain a small excess of peripherin over the amount required to form mature disks with normal incisures. Finally, the authors examined the effects of peripherin levels in rods from Xenopus tropicalis, an animal containing large OS disks with multiple incisures and three homologs of peripherin. They used gene editing to generate Xenopus tropicalis with a null mutation in the xrds35 gene, which is most like mammalian peripherin. OS disks from xrds35-/- frogs contained no incisures by EM tomography, further supporting their hypothesis.

Thank you for this nice summary of our study.

Another protein in the rims of rod OS disks is ABCA4, an ATP-driven flippase that translocates PE conjugated to retinaldehyde from the lumenal to cytoplasmic leaflets of the disk membrane. Retinaldehyde is a toxic photoproduct of rhodopsin bleaching. It has been suggested that the large number of incisures in frog disks is due to the larger diameter of frog versus mouse rod OS, and hence the greater number of rhodopsins per disk. This relationship is thought to ensure sufficient ABCA4 flippase activity to process the larger flux of retinaldehyde released by rhodopsin in these wide disks during light exposure, and possibly to minimize the diffusion distance of retinaldehyde from the disk lamella to the rim. The authors' findings seem in conflict with this explanation. They may wish to comment on this facet of their results.

We agree that it is possible for incisures to promote the encounter rate between retinaldehyde and ABCA4 in the disc. We do not find this idea to conflict with any of our interpretations; rather, this may be a complementary function of incisures. However, we failed to find any place in the literature where this hypothesis has been explicitly proposed and feel uneasy to present it as a new idea of our own in discussion. Fortunately, these reviews are public and truly interested readers could appreciate this idea. It is also worth noting that the correlation between incisure number and disc diameter is not perfect. For example, owl monkey discs appear to have a large number of incisures despite having a similar diameter to the mouse (Kroll and Machemer, PMID: 4970987).

Significance. The manuscript presents novel and significant findings into an important cell biological problem, development of the rod OS. It is clearly written and the data are of high quality. The manuscript should be of broad interest to cell biologists and vision scientists. It is strongly recommended for publication.

We are glad that the reviewer found our study to be of broad interest.

https://doi.org/10.7554/eLife.89160.sa2

Article and author information

Author details

  1. Tylor R Lewis

    Department of Ophthalmology, Duke University Medical Center, Durham, United States
    Contribution
    Conceptualization, Formal analysis, Funding acquisition, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    For correspondence
    tylor.lewis@duke.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6832-7972
  2. Sebastien Phan

    National Center for Microscopy and Imaging Research, School of Medicine, University of California, San Diego, La Jolla, United States
    Contribution
    Formal analysis, Investigation, Visualization, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  3. Carson M Castillo

    Department of Ophthalmology, Duke University Medical Center, Durham, United States
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  4. Keun-Young Kim

    National Center for Microscopy and Imaging Research, School of Medicine, University of California, San Diego, La Jolla, United States
    Contribution
    Investigation, Visualization, Writing – review and editing
    Competing interests
    No competing interests declared
  5. Kelsey Coppenrath

    Eugene Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, Woods Hole, United States
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  6. William Thomas

    Eugene Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, Woods Hole, United States
    Present address
    Department of Ecology and Evolution, Stony Brook University, Stony Brook, New York, United States
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  7. Ying Hao

    Department of Ophthalmology, Duke University Medical Center, Durham, United States
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  8. Nikolai P Skiba

    Department of Ophthalmology, Duke University Medical Center, Durham, United States
    Contribution
    Formal analysis, Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
  9. Marko E Horb

    Eugene Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, Woods Hole, United States
    Contribution
    Resources, Supervision, Funding acquisition, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  10. Mark H Ellisman

    National Center for Microscopy and Imaging Research, School of Medicine, University of California, San Diego, La Jolla, United States
    Contribution
    Resources, Formal analysis, Supervision, Funding acquisition, Methodology, Project administration, Writing – review and editing
    Competing interests
    No competing interests declared
  11. Vadim Y Arshavsky

    1. Department of Ophthalmology, Duke University Medical Center, Durham, United States
    2. Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, United States
    Contribution
    Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Methodology, Project administration, Writing – review and editing
    For correspondence
    vadim.arshavsky@duke.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8394-3650

Funding

National Institutes of Health (EY030451)

  • Vadim Y Arshavsky

National Institutes of Health (EY005722)

  • Vadim Y Arshavsky

National Institutes of Health (EY033763)

  • Tylor R Lewis

National Institutes of Health (OD010997)

  • Marko E Horb

National Institutes of Health (OD030008)

  • Marko E Horb

Research to Prevent Blindness (Unrestricted Award)

  • Vadim Y Arshavsky

National Institutes of Health (NS120055)

  • Mark H Ellisman

National Institutes of Health (GM82949)

  • Mark H Ellisman

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

The authors would like to thank Joseph Besharse and Dean Bok for helpful discussions during the course of this study. This work was supported by the NIH grants R01 EY030451 (VYA), P30 EY005722 (VYA), K99 EY033763 (TRL), P40 OD010997 (MEH), R24 OD030008 (MEH) and an Unrestricted Award from Research to Prevent Blindness Inc (Duke University). Electron tomography data acquisition, reconstruction and computer graphic segmentation and display were performed at the National Center for Microscopy and Imaging Research, with support from NIH grant U24 NS120055 (MHE). Deposition and management of acquired raw and derived electron tomography data within the Cell Image Library was further supported by NIH grant R01 GM82949 (MHE). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Ethics

Animal maintenance and experiments were approved by the Institutional Animal Care and Use Committees at Duke (Durham, NC; protocol #A184-22-10) and the Marine Biological Laboratory (Woods Hole, MA; protocol #22-29).

Senior Editor

  1. Lois EH Smith, Boston Children's Hospital, United States

Reviewing Editor

  1. Audrey M Bernstein, State University of New York Upstate Medical University, United States

Reviewer

  1. James B Hurley, University of Washington, United States

Version history

  1. Preprint posted: April 7, 2023 (view preprint)
  2. Received: May 5, 2023
  3. Accepted: July 13, 2023
  4. Accepted Manuscript published: July 14, 2023 (version 1)
  5. Version of Record published: July 21, 2023 (version 2)

Copyright

© 2023, Lewis et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 392
    Page views
  • 100
    Downloads
  • 3
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Tylor R Lewis
  2. Sebastien Phan
  3. Carson M Castillo
  4. Keun-Young Kim
  5. Kelsey Coppenrath
  6. William Thomas
  7. Ying Hao
  8. Nikolai P Skiba
  9. Marko E Horb
  10. Mark H Ellisman
  11. Vadim Y Arshavsky
(2023)
Photoreceptor disc incisures form as an adaptive mechanism ensuring the completion of disc enclosure
eLife 12:e89160.
https://doi.org/10.7554/eLife.89160

Share this article

https://doi.org/10.7554/eLife.89160

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Kristian Davidsen, Jonathan S Marvin ... Lucas B Sullivan
    Research Article

    Intracellular levels of the amino acid aspartate are responsive to changes in metabolism in mammalian cells and can correspondingly alter cell function, highlighting the need for robust tools to measure aspartate abundance. However, comprehensive understanding of aspartate metabolism has been limited by the throughput, cost, and static nature of the mass spectrometry (MS)-based measurements that are typically employed to measure aspartate levels. To address these issues, we have developed a green fluorescent protein (GFP)-based sensor of aspartate (jAspSnFR3), where the fluorescence intensity corresponds to aspartate concentration. As a purified protein, the sensor has a 20-fold increase in fluorescence upon aspartate saturation, with dose-dependent fluorescence changes covering a physiologically relevant aspartate concentration range and no significant off target binding. Expressed in mammalian cell lines, sensor intensity correlated with aspartate levels measured by MS and could resolve temporal changes in intracellular aspartate from genetic, pharmacological, and nutritional manipulations. These data demonstrate the utility of jAspSnFR3 and highlight the opportunities it provides for temporally resolved and high-throughput applications of variables that affect aspartate levels.

    1. Cell Biology
    2. Immunology and Inflammation
    Chinky Shiu Chen Liu, Tithi Mandal ... Dipyaman Ganguly
    Research Article

    T cells are crucial for efficient antigen-specific immune responses and thus their migration within the body, to inflamed tissues from circulating blood or to secondary lymphoid organs, plays a very critical role. T cell extravasation in inflamed tissues depends on chemotactic cues and interaction between endothelial adhesion molecules and cellular integrins. A migrating T cell is expected to sense diverse external and membrane-intrinsic mechano-physical cues, but molecular mechanisms of such mechanosensing in cell migration are not established. We explored if the professional mechanosensor Piezo1 plays any role during integrin-dependent chemotaxis of human T cells. We found that deficiency of Piezo1 in human T cells interfered with integrin-dependent cellular motility on ICAM-1-coated surface. Piezo1 recruitment at the leading edge of moving T cells is dependent on and follows focal adhesion formation at the leading edge and local increase in membrane tension upon chemokine receptor activation. Piezo1 recruitment and activation, followed by calcium influx and calpain activation, in turn, are crucial for the integrin LFA1 (CD11a/CD18) recruitment at the leading edge of the chemotactic human T cells. Thus, we find that Piezo1 activation in response to local mechanical cues constitutes a membrane-intrinsic component of the ‘outside-in’ signaling in human T cells, migrating in response to chemokines, that mediates integrin recruitment to the leading edge.