Lmx1b is required at multiple stages to build expansive serotonergic axon architectures

  1. Lauren J Donovan
  2. William C Spencer
  3. Meagan M Kitt
  4. Brent A Eastman
  5. Katherine J Lobur
  6. Kexin Jiao
  7. Jerry Silver
  8. Evan S Deneris  Is a corresponding author
  1. School of Medicine, Case Western Reserve University, United States

Abstract

Formation of long-range axons occurs over multiple stages of morphological maturation. However, the intrinsic transcriptional mechanisms that temporally control different stages of axon projection development are unknown. Here, we addressed this question by studying the formation of mouse serotonin (5-HT) axons, the exemplar of long-range profusely arborized axon architectures. We report that LIM homeodomain factor 1b (Lmx1b)-deficient 5-HT neurons fail to generate axonal projections to the forebrain and spinal cord. Stage-specific targeting demonstrates that Lmx1b is required at successive stages to control 5-HT axon primary outgrowth, selective routing, and terminal arborization. We show a Lmx1b→Pet1 regulatory cascade is temporally required for 5-HT arborization and upregulation of the 5-HT axon arborization gene, Protocadherin-alphac2, during postnatal development of forebrain 5-HT axons. Our findings identify a temporal regulatory mechanism in which a single continuously expressed transcription factor functions at successive stages to orchestrate the progressive development of long-range axon architectures enabling expansive neuromodulation.

https://doi.org/10.7554/eLife.48788.001

Introduction

Newly generated neurons dramatically transform their morphology to establish mature circuit connectivity. Some neurons, for example interneurons, connect to local circuits and thus need to extend their axons relatively short distances. In contrast, other neuron types, such as those giving rise to neuromodulatory systems, have the capacity to extend extremely long axons to innervate distant target fields. This is well exemplified in the case of serotonin (5-HT) synthesizing neurons. 5-HT modulates the excitability of nearly all neural circuitry in the brain and spinal cord despite being produced in a relatively small population of neurons (Azevedo et al., 2009; Baker et al., 1991; Hornung, 2003). Expansive serotonergic neuromodulation is achieved through the formation of long-range highly diffuse ascending and descending projection pathways that deliver 5-HT throughout the brain and spinal cord for synaptic or non-synaptic interactions with an array of receptors (Hannon and Hoyer, 2008; Steinbusch, 1981). Despite the decades-long knowledge of 5-HT’s importance as a global neuromodulator, it is not understood how these small numbers of neurons develop, over an extended period of morphological maturation, such elaborate axonal architectures.

5-HT neurons initiate axon outgrowth concomitant with their birth and onset of 5-HT synthesis (Hawthorne et al., 2010; Lidov and Molliver, 1982). Classic neuroanatomical studies have defined three successive stages, collectively spanning several weeks, in the formation of 5-HT projection pathways: primary pathway formation during which 5-HT axon outgrowth is initiated, selective pathway routing, and finally postnatal terminal arborization (Lidov and Molliver, 1982). Following primary pathway outgrowth through the medial forebrain bundle (MFB), ascending 5-HT axons originating in the dorsal raphe (DRN), median raphe (MRN) and B9 groups of midbrain/pons 5-HT neurons are selectively routed along pre-existing fiber tracts and reach all forebrain targets at parturition in an unarborized state (Bang et al., 2012; Lidov and Molliver, 1982; Muzerelle et al., 2016). Descending 5-HT axons, originating in the medullary serotonergic clusters, raphe pallidus (RPa), raphe obscurus (ROb), and raphe magnus (RMg), enter the spinal cord via the dorsolateral and ventral funiculi. These primary projections then route medially to invade nearly all lamina of the dorsal and ventral horns as well as the intermediate zone from cervical to sacral levels (Rajaofetra et al., 1989). After the major ascending and descending projection pathways are formed, a final, entirely postnatal, stage of 5-HT projection pathway maturation ensues during which 5-HT axons originating in different anatomically defined sub-regions flourish profuse terminal arbors in complementary and topographically organized patterns (Muzerelle et al., 2016; Ren et al., 2018). Terminal arborization develops at least through the first four postnatal weeks and leaves few, if any, regions of the brain and spinal cord devoid of serotonergic input (Gagnon and Parent, 2014; Hornung, 2003; Lidov and Molliver, 1982; Maddaloni et al., 2017; Steinbusch, 1981). What are the intrinsic mechanisms that govern successive stages in the formation of long-range profusely arborized 5-HT axon projection pathways and how are they temporally coordinated? One possibility is that each stage is governed by different intrinsic regulatory factors. Alternatively, a single continuously expressed intrinsic regulator may act at successive stages to orchestrate progressive morphological maturation of 5-HT pathways.

In contrast to the poor understanding of how 5-HT axonal pathways are formed, there is substantial knowledge of the gene regulatory networks (GRNs) that generate 5-HT neurons and control acquisition of 5-HT transmitter identity (Deneris and Gaspar, 2018). The LIM homeodomain protein, Lmx1b, is a crucial factor in 5-HT GRNs as 5-HT neuron selective targeting of Lmx1b results in the failure to induce Tph2 expression for 5-HT synthesis and Slc6a4 expression for 5-HT reuptake (Zhao et al., 2006). This results in extremely low levels of 5-HT in the adult brain, which is associated with high neonatal mortality and several abnormal behavioral phenotypes including hyperactivity, delayed respiratory maturation, enhanced inflammatory pain sensitivity, deficient opioid analgesia, sleep regulation, and increased contextual fear memories (Dai et al., 2008; Hodges et al., 2009; Zhang et al., 2018; Zhao et al., 2007a; Zhao et al., 2007b).

Lmx1b is a continuously expressed, terminal selector-type factor in 5-HT neurons (Hobert, 2008) raising the possibility that subsequent to its initial role in the induction of 5-HT synthesis and transport it may perform additional stage specific functions in the maturation of serotonergic connectivity. However, stage specific functions of continuously expressed terminal selectors, such as Lmx1b, in postmitotic neuronal morphological maturation are poorly understood (Deneris and Hobert, 2014; Hobert, 2016). Here, we report that lack of Lmx1b results in the failure to build long-range ascending and descending 5-HT axon projection pathways. Using temporal conditional targeting approaches we dissect distinct stage-specific functions for Lmx1b. Our findings show that Lmx1b acts at successive stages to control primary pathway growth rate, selective pathway routing and terminal arborization of 5-HT axons. We identify an ascending-specific Lmx1b-controlled regulatory cascade that regulates selective pathway routing and then switches to control forebrain 5-HT axon arborization through stage specific expression of genes required for arborization. This study demonstrates that a single continuously expressed transcription factor, initially required for induction of 5-HT synthesis and reuptake, subsequently acts at successive stages to build the expansive axon pathway architectures enabling CNS-wide serotonergic neuromodulation.

Results

Lmx1b controls formation of ascending 5-HT projection pathways

Conditional targeting of Lmx1b with the Pet1-Cre transgene results in loss of endogenous 5-HT neuron markers, Sert, Tph2, and 5-HT at E12.5 (Zhao et al., 2006). Therefore, we generated control (Lmx1b+/+;Pet1-Cre;Ai9) and Lmx1bcKO (Lmx1bfl/fl;Pet1-Cre;Ai9) mice in which the Ai9 reporter allele was used as a surrogate marker to specifically label Pet1+ cell bodies and their axons with red fluorescent protein, TdTomato. In control adult mice, 82% of Tph2+ neurons in the DRN and MRN express TdTomato. Conversely, approximately 88% of TdTomato+ cells co-label with Tph2; the remaining TdTomato+ cells likely express Tph2, but at a level insufficient for detection with standard IHC (Deneris and Gaspar, 2018; Okaty et al., 2015) (Figure 1—figure supplement 1A,B).

TdTomato+ cells were not found outside of the raphe nuclei (Figure 1—figure supplement 1B). TdTomato+ axons in control mice were widely distributed throughout the adult brain and colocalized with 5-HT (Figure 1—figure supplement 1C,D). The pattern of TdTomato+ axons in the control forebrain corresponded closely with the pattern of 5-HT axon distribution previously determined in the rat with an anti-5-HT antibody (Lidov and Molliver, 1982; Steinbusch, 1981). Similarly, TdTomato+ axon distribution in control brains was highly concordant with 5-HT axon projection patterns determined more recently using a mouse line in which GFP was knocked into the Tph2 coding region, thus validating our surrogate marking of 5-HT axons using a soluble reporter (Migliarini et al., 2013).

Abundant numbers of TdTomato+ cell bodies were detected in each of the raphe nuclei of Lmx1bcKO animals (Figure 1—figure supplement 1E). The vast majority of Lmx1bcKO TdTomato+ cells did not co-express Lmx1b or Tph2 (Figure 1—figure supplement 1E,F). Further, RT-qPCR analyses verified severe deficits of Lmx1b and Tph2 mRNAs in flow sorted YFP-labeled Pet1+ neurons in Lmx1bcKO mice, confirming appropriate Lmx1b targeting (Figure 1—figure supplement 1G). Counts of TdTomato+ cell bodies in Lmx1bcKO mice indicated that equivalent numbers were present compared to controls at 3 months and that their numbers remained stable for at least 13 months (Figure 1—figure supplement 1H,I). Lmx1bcKO TdTomato+ cell bodies were located within the normal cytoarchitectural boundaries of the raphe nuclei with a mildly altered distribution and smaller size (Figure 1—figure supplement 1I,J). Together, these data indicate specific fluorescent labeling of 5-HT neurons with Ai9 and efficient Lmx1b knock-down in Lmx1bcKO animals.

Analysis of TdTomato+ axons in adult Lmx1bcKO mice revealed a dramatically different pattern compared to that in control mice (Figure 1A,B). Although TdTomato+ axons were present in normal density and with proper ascending trajectory within the MFB of Lmx1bcKO mice, TdTomato+ axons were nearly completely missing throughout the forebrain of Lmx1bcKO animals distal to the thalamus (Figure 1B). Indeed, the vast majority of TdTomato+ axons failed to reach various distal fiber tracts including the fimbria-fornix, supracallosal stria, cingulum bundle, and olfactory tract (Figure 1B). Consequently, few if any TdTomato+ axons were present in the olfactory bulb, cortex, amygdala, hippocampus, striatum or many regions of the hypothalamus (Figure 1B–D; Figure 1—figure supplement 2A,B). It is likely that the few TdTomato+ 5-HT axons that did reach the distal forebrain were the result of a small number of 5-HT neurons in which Ai9 expression was activated, but Lmx1b targeting failed (Figure 1—figure supplement 1F).

Figure 1 with 2 supplements see all
Lmx1b is required for the formation of ascending 5-HT axon projection pathways.

(A, B) Ascending 5-HT axonal projection system immunolabeled using an anti-RFP antibody to TdTomato in whole sagittal forebrain sections of 3 month old mice displayed by heatmap. Lmx1bcKO TdTomato+ axons were nearly absent in numerous brain regions (B) compared to controls (A) (n = 6, controls; n = 7, Lmx1bcKO adult mice). Right, schematics depicting 5-HT axon trajectories in Lmx1bcKO vs. control brains. Scale bars, 1000 µm. OB, olfactory bulb; ctx, cortex; cg, cingulum; cc, corpus callosum; hipp, hippocampus; spt, septum; hyp, hypothalamus; thal, thalamus; sc, superior colliculus; MFB, medial forebrain bundle; DRN, dorsal raphe nucleus. Schematic (right): ot, olfactory tract; cg/SCS, cingulum/supracallosal stria; fx, fornix; sm, stria medularis; fr, fasciculus retroflexus. (C) Confocal images of TdTomato+ axons in sagittal sections. Lmx1bcKO axons failed to fill cingulum bundles or innervate the hippocampus. Scale bars, 200 µm. cg, cingulum; cc, corpus callosum; LSM, lacunosum moleculare; DG, dentate gyrus; CA1 of hippocampus. (D) Coronal sections of cortex show near complete lack of Lmx1bcKO TdTomato+ axons Scale bars, 50 µm. (E) Coronal view of altered patterns of TdTomato+ axons in Lmx1bcKO thalamus. Arrowheads indicate areas devoid of axons in Lmx1bcKO thalamus. Numbers correspond to areas of axon clumping in Lmx1bcKO thalamus. See Figure 1—figure supplement 2 for high magnification images. Scale bars, 100 µm. PVT, paraventricular nucleus of the thalamus; 3V, third ventricle.

https://doi.org/10.7554/eLife.48788.002

Although Lmx1bcKO TdTomato+ axons were present in the thalamus, the distribution of their terminal arbors was quite different from that in controls (Figure 1B,E). We found aberrant clumping of mutant TdTomato+ terminal arbors in several intralaminar thalamic nuclei (Figure 1E; Figure 1—figure supplement 2C). Many regions were completely devoid of arbors unlike the relatively homogeneously tiled distribution in the control thalamus (Figure 1E, arrowheads). In addition, the conspicuously dense 5-HT arborization that demarcates the paraventricular nucleus of the thalamus (PVT) was completely absent in Lmx1bcKO mice (Figure 1E; Figure 1—figure supplement 2D).

To verify the deficit of TdTomato+ axons in the forebrain of Lmx1bcKO mice, we performed a second method of axon labeling by stereotaxic injection of an AAV2 virus expressing a Cre-dependent membrane bound channelrhodopsin with a YFP tag (rAAV2/Ef1a-DIO-hchR2-EYFP) into the midbrain of adult control and Lmx1bcKO mice. In Lmx1bcKO mice, we found an absence of YFP+ axons in all of the distal areas in which TdTomato+ axons were absent. Moreover, YFP+ axons were colocalized in all forebrain areas with TdTomato+ axons (Figure 1—figure supplement 1K,L).

Lmx1b controls formation of descending 5-HT projection pathways

As Lmx1b is strongly expressed in all medullary raphe 5-HT neurons, we next investigated descending 5-HT axon development. In control animals, 80% of Tph2+ medullary cell bodies expressed TdTomato and 92% of TdTomato+ cell bodies were co-labeled with Tph2 (Figure 2—figure supplement 1A). TdTomato+ axon patterns in control E15.5 embryos corresponded closely with the pattern of developing 5-HT-labeled axons in the ventral and lateral funiculi of the spinal cord, thus indicating specific labeling of descending 5-HT axons with TdTomato (Figure 2—figure supplement 1B). In addition, the pattern of control TdTomato+ axon distribution throughout the embryonic and adult spinal cord corresponded to descending 5-HT axons patterns in gray and white matter described in the rat and mouse with an anti-5-HT antibody (Ballion et al., 2002; Rajaofetra et al., 1989). We confirmed that the number of TdTomato-labeled Pet1+ neurons in the medullary raphe nuclei did not differ between Lmx1bcKO and control mice at 3 months of age (Figure 2—figure supplement 1C). Further, Lmx1bcKO TdTomato+ cells did not express Tph2, confirming targeting of Lmx1b (Figure 2—figure supplement 1D).

We found a severe lack of TdTomato+ axons in the white matter funiculi, through which 5-HT axon projections normally extend caudally through the spinal cord (Figure 2A; Figure 2—figure supplement 2A). In addition, a severe reduction of Lmx1bcKO TdTomato+ axons was found in gray matter at all levels of the spinal cord (Figure 2A). The normally dense innervation to the dorsal and ventral horns of control spinal cords was dramatically decreased in cervical, thoracic and lumbar levels in Lmx1bcKO mice (Figure 2A; Figure 2—figure supplement 2B,C). At cervical levels there was a 67% deficit of TdTomato+ axons in white matter while at lumbar levels there was a 92% deficit (Figure 2B). Quantitation of TdTomato+ axons in gray matter revealed a progressive cervical to lumbar deficit, 73% and 94%, respectively in Lmx1bcKO cords compared to control cords (Figure 2C). Collectively, our results indicate that Lmx1b deficiency severely disrupts long-range 5-HT axon architecture in the forebrain and spinal cord and that the deficit becomes increasingly profound with increasing distance from 5-HT cell bodies.

Figure 2 with 2 supplements see all
Lmx1b is required for the formation of descending 5-HT axon projection pathways.

(A) Coronal sections taken at cervical (C4), thoracic (T6), and lumbar (L3) levels of the spinal cord (diagram, left). Immunolabeling for TdTomato shows Lmx1bcKO axons were severely reduced at every level of the cord in both gray and white matter compared to controls. Scale bars, 200 µm. m, midline; med, medulla; cc, central canal; dh, dorsal horn; vh, ventral horn; lat fun, lateral funiculi. (B, C) Quantification of total TdTomato+ axons (pixels/µm2) in white (B) and gray (C) matter at cervical and lumbar levels (n = 3, control; n = 3 Lmx1bcKO mice). Two-way ANOVA with Welch’s correction, *p<0.05, **p<0.001, and ***p<0.0001. Data are represented as mean ± SEM.

https://doi.org/10.7554/eLife.48788.005

Delayed primary pathway formation and aborted selective pathway routing in Lmx1bcKO mice

We next followed the development of Lmx1bcKO TdTomato+ axons to distinguish among several possible explanations for the dramatic defects in ascending and descending 5-HT axon pathways: i, disrupted primary pathway formation; ii, failure to selectively route axons through pre-existing tracts; iii, abnormal axon trajectories with subsequent failure to extend, iv, normal pathway development followed by dieback. We first investigated TdTomato+ axons at E13.5 when primary pathway formation is underway and Lmx1b conditional targeting has occurred. At this stage, TdTomato+ axon outgrowth and trajectory in Lmx1bcKO mice were normal as they coursed through the MFB over the mesencephalic flexure (Figure 3A). At E16.5, however, Lmx1bcKO TdTomato+ axons exhibited a clear failure to extend as far rostrally as control axons, suggesting either aborted or delayed axon outgrowth along the more rostral portions of the MFB during late stage primary pathway formation (Figure 3B). At E18.5, the density of control TdTomato+ axons was maximal throughout the MFB and TdTomato+ axons were present as far rostral as the septum and diagonal band, where 5-HT axons turn dorsally to navigate through the cingulum, supracallosal stria, and fimbria-fornix (Figure 3C). Lmx1bcKO TdTomato+ axons now appeared at normal density throughout the MFB, thus supporting delayed axon outgrowth at E16.5 (data not shown). However, at this stage, most Lmx1bcKO TdTomato+ axons failed to turn dorsally and remained stalled within the MFB. A smaller number of Lmx1bcKO TdTomato+ axons did turn dorsally away from the MFB to pass through the septum and diagonal band (Figure 3C). Virtually all Lmx1bcKO axons failed to extend and selectively route into the cingulum and fimbria-fornix, thus failing to reach the cortex and hippocampus. Lmx1bcKO TdTomato+ axons still did not exhibit ectopic trajectories. Further examination in one-month old Lmx1bcKO animals revealed a similar deficit of TdTomato+ axons in distal forebrain tracts (data not shown). These findings suggest that conditional targeting of Lmx1b at E12.5 results in delayed primary pathway formation followed by a profound failure of ascending axons to selectively route into pre-existing fiber tracts.

Initial axon outgrowth is delayed and selective pathway routing fails in Lmx1b deficient 5-HT neurons.

(A–C) Immunolabeled TdTomato+ ascending axons in sagittal slices at different embryonic stages. Diagrams (left) show area of image (red box) presented for each time point. Arrows indicate direction of growing axons. E13.5 Lmx1bcKO axons exhibited similar ascending trajectories and densities as controls (A). E16.5 Lmx1bcKO axons did not extend as far (asterisk) and were less abundant (under bracket) compared to control axons (B). E18.5 Lmx1bcKO axons failed to fill multiple axon tracts (cg, fx; asterisks) compared to controls (C). Scale bars, 50 µm (A), 200 µm (B,C). DRN, dorsal raphe nucleus; MFB, medial forebrain bundle; mes, mesencephalic flexure; cg, cingulum bundle; fx, fornix; ac, anterior commissure; spt, septum; db, diagonal band; cc, corpus callosum. (D) Diagram (left) depicting coronal section of an embryonic spinal cord. TdTomato+ descending axons at E15.5 in control vs Lmx1bcKO embryos. Lmx1bcKO axons exit caudal medulla similar to controls but were severely reduced in funiculi at lower levels of the cord (mid-cervical and lumbar). Boxed region of lateral funiculi enlarged to the right of each image. Scale bars, 100 µm (low magnification), 50 µm (high magnification-medulla), 20 µm (high magnification- cervical/lumbar insets). Lat fun, lateral funiculi; cc, central canal; m, midline; D, dorsal; V, ventral.

https://doi.org/10.7554/eLife.48788.008

Analysis of descending TdTomato+ fibers at E15.5 revealed similar initial axon outgrowth through the caudal medulla to the upper cervical spinal cord from Lmx1bcKO and control medullary 5-HT cell bodies (Figure 3D). Although Lmx1bcKO TdTomato+ axons appropriately entered the lateral and ventral funiculi of the cervical spinal cord, greatly reduced densities were evident beginning at mid-cervical levels (Figure 3D). At lumbar levels, Lmx1bcKO TdTomato+ axons were nearly undetectable in the lateral and ventral funiculi (Figure 3D). These results indicate that TdTomato+ axons were not able to extend into the funiculi, which caused a severe and progressive cervical to lumbar deficit of 5-HT innervation in the adult Lmx1bcKO spinal cord (Figures 2 and 3D).

Lmx1b acts temporally to control 5-HT axon selective pathways

As formation of 5-HT axon projection pathways occurs over several weeks of embryonic to early postnatal neural maturation we next sought to determine whether Lmx1b is temporally required for 5-HT axon pathway formation. To address this question, we developed a tamoxifen inducible targeting strategy (Figure 4A) to knock-down Lmx1b at different early postnatal timepoints. Thus, we generated Lmx1bicKO (Lmx1bfl/fl; Tph2-CreER; Ai9) and iControl (Lmx1b+/+; Tph2-CreER; Ai9) mice. Subcutaneous delivery of tamoxifen into iControl pups resulted in approximately 94% of Tph2+ neurons co-labeled with TdTomato in the DRN/MRN/B9 (Figure 4—figure supplement 1A,B). Conversely, 94% of TdTomato+ cells were co-labeled with Tph2 (Figure 4—figure supplement 1B). As with the Pet1-Cre driver, the Tph2-CreER activated TdTomato+ cells that are Tph2- evidently express Tph2 at a low level (Deneris and Gaspar, 2018; Okaty et al., 2015). RT-qPCR analysis of flow sorted TdTomato+ cells verified that Lmx1b mRNA was significantly reduced in Lmx1bicKO mice (Figure 4B). Equivalent numbers of TdTomato-labeled cell bodies were generated in Lmx1bicKO versus iControl mice after injection of tamoxifen (Figure 4—figure supplement 1C,D). In contrast to Lmx1bcKO TdTomato+ cells, cell body size and distribution of tamoxifen treated Lmx1bicKO TdTomato+ cells were not different from that of iControl TdTomato+ cells (Figure 4—figure supplement 1C,E).

Figure 4 with 1 supplement see all
Lmx1b is temporally required for 5-HT projection pathway formation.

(A) Schematic of tamoxifen-inducible approach to target Lmx1b at postnatal day (P)1. (B) RT-qPCR of flow sorted TdTomato+ neurons from postnatal targeted mice (n = 3, iControl; n = 4, Lmx1bicKO mice). Unpaired t-test with Welch's correction, *p<0.05. Data are represented as mean ± SEM. (C) Coronal sections of P1 targeted Lmx1bicKO hippocampus compared to iControls analyzed at P31. *, incomplete formation of SCS and cingulum in P1 targeted Lmx1bicKO brain. Scale bars, 200 µm. (D) Coronal sections of P1 targeted Lmx1bicKO cortex compared to iControls analyzed at P31. Scale bars, 200 µm. (E) Coronal sections at level of corpus callosum showing incomplete formation of major 5-HT axon routes, SCS and cingulum, in P1 targeted Lmx1bicKO forebrain compared to iControls (above dotted line). Scale bars, 100 µm. cg, cingulum; SCS, supracallosal stria; cc, corpus callosum; m, midline. (F) Quantification of axons within SCS and cingulum tracts (n = 3, iControl; n = 3, Lmx1bicKO mice). Unpaired t-test with Welch's correction, p=0.0112. Data are represented as mean ± SEM.

https://doi.org/10.7554/eLife.48788.009

We analyzed TdTomato+ axons in P1 targeted Lmx1bicKO mice four weeks after tamoxifen delivery, when 5-HT axon pathways have fully matured (Lidov and Molliver, 1982; Maddaloni et al., 2017). We found a dramatic deficit in TdTomato+ arbors throughout the hippocampus in Lmx1bicKO mice compared to controls (Figure 4C). In addition, TdTomato+ arbors were severely reduced in all layers of the cortex with the most medial layers almost completely devoid of arbors in Lmx1bicKO mice (Figure 4D). These results clearly demonstrate that Lmx1b is temporally required for postnatal development of 5-HT terminal axons. However, we noticed that in addition to reduced 5-HT arbors in the hippocampus and cortex, TdTomato labeling within the supracallosal stria and cingulum, major routes to the hippocampus and cortex, were consistently less intense in P1 targeted Lmx1bicKO mice compared to controls (Figure 4C, asterisk). Indeed, further detailed examination revealed that these major 5-HT routes had not yet fully formed (Figure 4E). Quantification of TdTomato+ axons within the cingulum and supracallosal stria tracts confirmed a significant decrease in P1 targeted Lmx1bicKO mice compared to controls (Figure 4F). These results indicate that i, long-range 5-HT axon routing is continuing to develop in the early neonatal period and ii, Lmx1b is required at this stage for completion of 5-HT axon selective routing.

Lmx1b switches function to control terminal arborization

We next targeted Lmx1bicKO mice at P3 to further investigate temporal requirements for Lmx1b (Figure 5A). Importantly, in contrast to findings obtained in P1 targeted mice, we found that the density of TdTomato-labeled fibers in the supracallosal stria was now similar in P3 targeted Lmx1bicKO and iControl mice (Figure 5—figure supplement 1A). Furthermore, TdTomato-labeled fibers in the cingulum, one of the longest of 5-HT forebrain tracts, was now comparable in P3 targeted Lmx1bicKO and iControl mice (Figure 5B). Quantification of the cingulum and supracallosal stria confirmed no significant difference between P3 targeted Lmx1bicKO and iControl mice (Figure 5—figure supplement 1B). These findings indicate that 5-HT axon routing was complete in P3 targeted Lmx1bicKO mice.

Figure 5 with 1 supplement see all
Lmx1b temporally controls postnatal 5-HT terminal arborization.

(A) Schematic of tamoxifen inducible targeting of Lmx1b at postnatal day (P)3. (B) Sagittal view of cingulum shows fully formed long-range axon routes in P3 targeted Lmx1bicKO mice compared to iControls. Scale bars, 200 µm. (C) Coronal sections of hippocampus in P3 targeted Lmx1bicKO mice compared to iControls. Dashed boxed region: higher magnification image at right highlighting reduced TdTomato+ axons in Lmx1bicKO SLM. Scale bars, 200 µm (low magnification), 50 µm (high magnification). SLM, stratum lacunosum moleculare; DG, dentate gyrus. (D) Coronal sections of cortex of P3 targeted Lmx1bicKO mice compared to iControls. Imaris tracing; right panels. Scale bars, 100 µm. (E) Decreased TdTomato+ arbors detected in P3 targeted Lmx1bicKO PVT compared to iControls (arrows). Scale bars, 50 µm.

https://doi.org/10.7554/eLife.48788.011

Despite fully developed 5-HT selective pathway routes in the forebrain, TdTomato+ arbors were significantly decreased throughout the hippocampus (Figure 5C; Figure 5—figure supplement 1B). A majority of remaining arbors detected within the hippocampus of P3 targeted Lmx1bicKO mice were found in the molecular layer (SLM), which are the first 5-HT arbors to appear in the hippocampus during rat development (Lidov and Molliver, 1982). TdTomato+ arbors were also severely decreased in all cortical layers of the P3 targeted Lmx1bicKO brain including in layer I and VI where axons of passage also exist (Figure 5D) (Lidov and Molliver, 1982). Quantification of the cortex confirmed a significant decrease of TdTomato+ axon arbors in P3 targeted Lmx1bicKO compared to iControls (Figure 5—figure supplement 1B). It is important to note that many 5-HT terminal arbors have already been generated in the forebrain at P3 (Lidov and Molliver, 1982; Maddaloni et al., 2017). Thus, Lmx1b targeting at P3 results in the failure of new arbors to form while leaving previously generated arbors intact.

Interestingly, arborization deficits were also found within the thalamus of P3 targeted Lmx1bicKO mice. Similar to what we observed in Lmx1bcKO mice, the normally dense arborization within the PVT was absent in P3 targeted Lmx1bicKO mice, rendering the PVT indiscernible (Figure 5E). Together, these results reveal a successive stage of continuous Lmx1b function during which it switches to control terminal arborization of forebrain 5-HT axons.

Targeting of 5-HT synthesis does not impair formation of forebrain and spinal cord 5-HT arbors

Lack of 5-HT itself has been reported to affect development of forebrain 5-HT terminal arbor patterns (Migliarini et al., 2013). Therefore, we next investigated whether the arborization defects present in Lmx1b deficient mice resulted from reduced Tph2 expression and consequently reduced 5-HT levels. To specifically knock down Tph2 to a level comparable to that in Lmx1bcKO mice, we generated Tph2cKO (Tph2fl/fl;Pet1-Cre;Ai9) and control (Tph2+/+;Pet1-Cre;Ai9) mice. The numbers of TdTomato+ cells in each raphe nuclei did not differ in Tph2cKO and control mice (Figure 6A). In the DRN/MRN/B9 nuclei, we found a 74% reduction of Tph2+ neurons in Tph2cKO compared to the 79% reduction of Tph2+ neurons in Lmx1bcKO mice (Figure 6B,C). Additionally, we confirmed loss of 5-HT itself in Tph2cKO mice (Figure 6D).

Specific targeting of 5-HT synthesis does not alter 5-HT arborization patterns.

(A) Counts of TdTomato+ cells in each raphe nucleus of Tph2cKO mice did not differ from controls (n = 2 mice/genotype). Data are represented as mean ± SEM. (B) Comparable Tph2 knock-down in Tph2cKO and Lmx1bcKO mice. Scale bars, 100 µm. (C) Cell counts of residual Tph2+ neurons in Tph2cKO and Lmx1bcKO mice expressed as a percentage (n = 2 mice/genotype). Data are represented as mean ± SEM. (D) Immunolabeling shows 5-HT was severely reduced in Tph2cKO mice. Scale bars, 100 µm. (E) Coronal forebrain sections showing no deficits of TdTomato+ axon densities in Tph2cKO hippocampus, PVT, and cortex (n = 3 mice/genotype). LSM, lacunosum moleculare; DG, dentate gyrus; CA1 of hippocampus. Scale bars, 100 µm (PVT, cortex); 200 µm (hippocampus). (F) Co-immunolabeling for Tph2 and TdTomato in medullary neurons. Tph2 expression was severely reduced in medullary neurons of Tph2cKO mice. Scale bars, 50 µm. (G) No deficits of TdTomato+ axons were present throughout the Tph2cKO spinal cord (n = 3 mice/genotype). Scale bars, 200 µm.

https://doi.org/10.7554/eLife.48788.013

We analyzed TdTomato+ terminal arbors throughout the forebrain in adult Tph2cKO mice. We did not find differences in Tph2cKO versus control TdTomato-labeled arbor patterns anywhere in the forebrain including the hippocampus, cortex, and the PVT (Figure 6E). Further, despite loss of Tph2 in medullary neurons of Tph2cKO mice (Figure 6F), analysis of the spinal cord from cervical to lumbar levels revealed no differences in axon densities compared to control mice (Figure 6G). Collectively, these results indicate that the loss of Tph2 and thus reduced levels of 5-HT in Lmx1bcKO or Lmx1bicKO mice did not contribute to either the routing or arborization defects. Evidently, Tph2 and 5-HT levels need to be reduced to a greater extent than we achieved in either our Lmx1bcKO or our Tph2cKO mice to generate the 5-HT arborization defects observed in mice engineered to completely eliminate Tph2 function and brain 5-HT (Migliarini et al., 2013).

Lmx1b controlled axon-related transcriptomes

Genome-wide analysis of Lmx1b controlled serotonergic transcriptomes has not been performed and consequently only a few serotonergic genes are known Lmx1b targets (Zhao et al., 2006). We performed RNA-sequencing (RNA-seq) on flow sorted rostral hindbrain 5-HT neurons, which give rise to the ascending system, and caudal hindbrain 5-HT neurons, which give rise to the descending system, obtained from Lmx1bcKO and control E17.5 embryos (Figure 7A). Differential expression analysis revealed that the known Lmx1b target genes, Tph2, Slc18a2, Slc6a4, SCG II, Ctr, were significantly decreased in our E17.5 rostral and caudal Lmx1bcKO datasets. Moreover, we found significantly decreased expression of other 5-HT pathway genes, Ddc, Slc22a3, Htr1a, Gch1, Gchfr, in both rostral and caudal Lmx1bcKO sorted 5-HT neurons that were previously unknown Lmx1b targets (Figure 7B,C).

Ascending and descending Lmx1b regulated transcriptomes.

(A) Schematic for dissection of E17.5 brain to isolate rostral and caudal 5-HT neurons genetically labeled by Pet1-EYFP. After dissection, EYFP+ neurons were flow-sorted separately and prepared for RNA-sequencing (n = 3, controls; n = 2 Lmx1bcKO embryos). (B) Relative expression level of 5-HT pathway genes in rostral control versus Lmx1bcKO 5-HT neurons. Control gene expression levels were normalized to one. * indicates FDR ≤ 0.05. Data are represented as mean ± SEM. (C) Relative expression level of 5-HT pathway genes in caudal control versus Lmx1bcKO 5-HT neurons. Control gene expression levels were normalized to one. * indicates FDR ≤ 0.05. Data are represented as mean ± SEM. (D) Volcano plot for rostral control versus Lmx1bcKO differential expression. Significantly altered genes are in red with ≥log2(1.5X) and FDR ≤ 0.05. (E) Volcano plot for caudal control versus Lmx1bcKO differential expression. Significantly altered genes are in red with ≥log2(1.5X) and FDR ≤ 0.05. (F) Venn diagram of genes upregulated in rostral and caudal Lmx1bcKO 5-HT neurons. (G) Venn diagram of genes downregulated in rostral and caudal Lmx1bcKO 5-HT neurons. (H) Heatmap of differentially-expressed genes in rostral and caudal Lmx1bcKO 5-HT neurons. (I) GO term enrichment of Lmx1b regulated genes. BP = biological process, CC = cellular component, MF = molecular function. GO terms were enriched with FDR ≤ 0.05. (J) Relative expression (FPKMs) of known 5-HT neuron axon-related genes in rostral Lmx1bcKO 5-HT neurons. Data are represented as mean ± SEM. (K) Relative expression (FPKMs) of known 5-HT neuron axon-related genes in caudal Lmx1bcKO 5-HT neurons. Data are represented as mean ± SEM. (L) Relative expression (FPKMs) of 5-HT GRN transcription factors in rostral Lmx1bcKO 5-HT neurons. Data are represented as mean ± SEM. (M) Relative expression (FPKMs) of 5-HT GRN transcription factors in caudal Lmx1bcKO 5-HT neurons. Data are represented as mean ± SEM. (N) Relative expression (FPKMs) of 5-HT GRN transcription factors in flow sorted TdTomato+ rostral Lmx1bcKO 5-HT neurons at postnatal day 2 (n = 3, controls; n = 4, Lmx1bcKO mice). Data are represented as mean ± SEM. (O) RT-qPCR verification of 5-HT GRN transcription factors and known axon-related genes from flow sorted rostral YFP+ Lmx1bcKO 5-HT neurons relative to control levels (n = 4 mice/genotype). * indicates p-value≤0.05, # indicates p<0.1, t-test with Welch’s correction. Data are represented as mean ± SEM.

https://doi.org/10.7554/eLife.48788.014

In addition to these changes, expression of many other genes was altered in the rostral and caudal sorted neurons (Figure 7D,E). In rostral Lmx1bcKO neurons, expression of 784 genes were significantly decreased, while 118 genes showed significantly increased expression (Figure 7F,G). In caudal Lmx1bcKO neurons, expression of 1529 genes were significantly decreased and 772 were significantly increased (Figure 7F,G). Although there were many genes commonly regulated by Lmx1b, many more were uniquely regulated by Lmx1b in rostral versus caudal 5-HT neurons (Figure 7F–H).

Over-representation analysis of Gene Ontology (GO) terms from rostral and caudal Lmx1b-regulated 5-HT neuron genes revealed a pattern of strong enrichment for genes involved in axon development and morphogenesis (Figure 7I). In fact, the top enriched GO term, axon development, represents over 150 genes with a Benjamini-Hochberg (BH) adjusted p-value of 0. Many other axon-related terms included axon part, cell leading edge, regulation of supramolecular fiber organization, neuron projection fasciculation, tissue migration, cell-substrate adhesion, negative chemotaxis, morphogenesis of a branching structure, cell leading edge, extracellular matrix binding, and semaphorin receptor binding were enriched at FDR ≤ 0.05. Grouping the genes from all of these axon-related categories together produced a dataset of 422 genes regulated by Lmx1b in rostral and/or caudal 5-HT neurons that have known roles in axon development or function (Supplementary file 1). Sixty-six of these downstream genes were significantly altered in both the ascending and descending 5-HT subsystems; 71 genes were uniquely altered in the ascending subsystem while 285 were uniquely altered in the descending subsystem. This analysis suggests that Lmx1b coordinates distinct axonal regulatory programs and transcriptomes to build the two divergent axonal subsystems.

Previous studies have implicated several effector genes in the growth and patterning of 5-HT axons (Chen et al., 2017; Donovan et al., 2002; Fournet et al., 2010; Katori et al., 2017; Lee et al., 2005). In most cases, however, is it not known whether these genes perform cell intrinsic functions in 5-HT neurons. Examination of our rostral and caudal RNA-seq datasets revealed significantly decreased expression of most but not all of these genes (Figure 7J,K). We validated the expression changes of these genes with RT-qPCR from flow-sorted E17.5 rostral 5-HT neurons (Figure 7O). Together, these expression studies suggest Lmx1b controls ascending and descending 5-HT projection pathways in part through Gap43, Pcdhac2, Ndn, Ret, Ntrk2, Map6 (STOP), and Celsr3 but that potentially hundreds of other functionally diverse Lmx1b-controlled genes are likely involved in the formation of 5-HT projection pathways (Figure 7J,K,O; Supplementary file 1).

An ascending-specific axonal Lmx1b→Pet1 regulatory cascade

The regulatory interactions among transcription factors in the 5-HT GRN are poorly understood but are likely to be important for the development of 5-HT neurons. We reasoned that further study of these interactions might illuminate the regulatory mechanisms through which Lmx1b temporally controls formation of ascending and descending 5-HT axon pathways. Our whole genome expression analyses revealed complex effects of Lmx1b deficiency on the expression of other regulatory factors in the 5-HT GRN (Figure 7L–O). Decreased Pet1 expression was the most consistent and persistent change among the regulatory factors in the rostral and caudal 5-HT GRNs after conditional targeting of Lmx1b, which raised the possibility that an Lmx1b→Pet1 regulatory cascade acts in the formation of 5-HT axons.

To investigate this idea, we generated Pet1cKO (Pet1fl/fl;Pet1-Cre;Ai9) and control (Pet1+/+;Pet1-Cre;Ai9) mice (Liu et al., 2010). We imagined three alternative experimental outcomes: i, Pet1cKO fully phenocopies the axon defects found in Lmx1bcKO supporting an exclusive Lmx1b→Pet1 regulatory cascade in 5-HT axon formation, ii, 5-HT axon projection pathways are intact in Pet1cKO mice and therefore the Lmx1b→Pet1 regulatory path is not operational in 5-HT axon development or iii, Pet1cKO incompletely phenocopies Lmx1bcKO axon defects suggesting that the Lmx1b→Pet1 cascade operates in parallel with other Lmx1b orchestrated regulatory programs.

We first examined TdTomato+ axon patterns in adult Pet1cKO versus control spinal cords. We confirmed Pet1 transcript loss in medullary 5-HT neurons by in situ hybridization (ISH) (Figure 8—figure supplement 1A). TdTomato+ axon patterns from cervical to lumbar levels of the spinal cord were similar in Pet1cKO and control mice (Figure 8A). Quantitation of total TdTomato+ axons in gray and white matter revealed no significant difference between Pet1cKO and control mice (Figure 8B). These findings indicate that Pet1, and consequently the hypothetical Lmx1b→Pet1 cascade, is not required for the formation of descending 5-HT axon pathways (Figure 8—figure supplement 1E).

Figure 8 with 2 supplements see all
Distinct transcription factor requirements in the formation of ascending and descending 5-HT projection pathways.

(A) TdTomato+ axon innervation in Pet1cKO vs control spinal cords in 3 month old mice. Coronal semi-section views of cervical and lumbar levels. Scale bars, 200 µm. cc, central canal; dh, dorsal horn; vh, ventral horn; fun, funiculi. (B) Quantification of TdTomato+ axons (pixels/µm2) in cervical and lumbar spinal cords (n = 3, controls; n = 3, Pet1cKO animals; Two-way ANOVA; white matter: cervical p=0.1372; lumbar p=0.6764; gray matter: cervical p=0.4440; lumbar p=0.1995). Data are represented as mean ± SEM. (C) Decreased TdTomato+ arbors detected in Pet1cKO hippocampus compared to controls at 3 months of age. Scale bars, 200 µm, sagittal view. (D) Decreased TdTomato+ arbors detected in Pet1cKO cortex compared to controls at 3 months of age. Scale bars, 100 µm, coronal view. (E) Decreased TdTomato+ arbors detected in Pet1cKO olfactory bulb compared to controls at 3 months of age. Scale bars, 50 µm, sagittal view. cg, cingulum; cc, corpus callosum; LSM, lacunosum moleculare; DG, dentate gyrus; CA1 of hippocampus; gr, granule layer; gl, glomerular layer.

https://doi.org/10.7554/eLife.48788.015

We next investigated the Pet1cKO forebrain and found in striking contrast to the spinal cord that few if any TdTomato+ axons were present in the olfactory bulb, cortex, amygdala, hippocampus, striatum and many regions of the hypothalamus in Pet1cKO forebrains (Figure 8C–E). Furthermore, the pattern of TdTomato+ axons in the thalamus of Pet1cKO mice was severely disrupted with notable patches of clumped fibers and other areas with few, if any, fibers (Figure 8—figure supplement 1B). Similar to Lmx1bcKO mice, TdTomato+ axons were present in normal density and with proper ascending trajectory within the MFB of Pet1cKO mice (Figure 8—figure supplement 1C). These findings clearly demonstrate a requirement for Pet1 in forebrain 5-HT pathway formation and thus distinct transcription factor requirements in the generation of ascending and descending 5-HT axon projection pathways.

Although Pet1 conditional targeting largely phenocopies the forebrain 5-HT axon defects found in Lmx1bcKO mice, we noticed distinctly different patterns of TdTomato+ arbors in the Pet1cKO vs. Lmx1bcKO thalamus (Figure 8—figure supplement 1B). The Pet1cKO thalamus lacked TdTomato+ axons in lateral regions while in other thalamic regions we found abnormal clumping of Pet1cKO TdTomato+ axons (Figure 8—figure supplement 1B). Further, in contrast to the failure of Lmx1bcKO axons to demarcate the PVT, Pet1cKO TdTomato+ axons were properly patterned in this region (Figure 8—figure supplement 1B). This suggests Lmx1b may act independently of Pet1 in this specific highly discrete target field. Interestingly, early Pet1 deficiency did not result in reduced cell body size thus demonstrating that reduced cell body size did not contribute to the axon defects in Lmx1bcKO mice (Figure 8—figure supplement 1D). The robust similarities and yet distinct differences in TdTomato+ axon patterns in Pet1cKO compared to Lmx1bcKO forebrain support a model in which Lmx1b→Pet1 is the main regulatory program but that additional minor Lmx1b- or Pet1-orchestrated regulatory pathways operate in building ascending 5-HT axonal architectures (Figure 8—figure supplement 1F).

We investigated whether Lmx1b and Pet1 compensate for one another in the formation of 5-HT axons, by examining double-targeted mice (DKO: Lmx1bfl/fl; Pet1fl/fl;Pet1-Cre;Ai9) and controls (Lmx1b+/+; Pet1+/+;Pet1-Cre;Ai9). Analysis of DKO spinal cords revealed deficits in TdTomato+ axons patterns to similar levels as Lmx1bcKO spinal cord, further confirming Pet1 does not play a role in descending 5-HT axon development (Figure 8—figure supplement 2A). In the forebrain, we did not find a more extreme deficit in TdTomato+ axons in DKO mice compared to Lmx1bcKO mice. The DKO thalamus mirrored the Lmx1bcKO thalamus in the specific clumping of arbors and inability to properly pattern arbors in the PVT (Figure 8—figure supplement 2B).

To investigate whether the initial 1–2 days of Pet1 expression, not targeted by Pet1-Cre in Pet1cKO mice is required for primary ascending pathway formation, we analyzed Pet1-/-;Pet1-YFP mice in which the Pet1-YFP transgene labels control and mutant Pet1+ cell bodies and their axons with YFP (Hawthorne et al., 2010). We found comparable initial 5-HT primary axon outgrowth in Pet1-/- and control 5-HT neuron cell bodies at E13.5 (Figure 8—figure supplement 2C).

Lmx1b acts through Pet1 to temporally control postnatal stage-specific gene expression and forebrain arborization

Stage-specific regulatory functions suggest potential stage-specific control of gene expression to fulfill successive steps in the morphological maturation of axon projection pathways. Thus, we next sought to determine whether the Lmx1b→Pet1 cascade temporally regulates expression of axon-related genes that are required at specific stages of 5-HT pathway formation. We found that Lmx1b continues to control Pet1 postnatally as Pet1 transcript levels were decreased in P3 targeted Lmx1bicKO mice (Figure 9A,B). Next, we used RNA-sequencing to find common Lmx1b and Pet1 targets. Comparing rostral Lmx1b and Pet1 regulated genes, we found 82 regulated genes present in both datasets (Figure 9C). By intersecting rostral Lmx1b and Pet1 regulated genes with the set of Lmx1b-regulated axon-related genes (Supplementary file 1), we found 15 co-regulated genes (Figure 9C). Interestingly, one of these coregulated genes is Pcdhac2. Extensive studies of Pcdhac2 have demonstrated its key intrinsic role in the formation and patterning 5-HT axon arbors (Chen et al., 2017; Katori et al., 2009; Katori et al., 2017). In particular, Pcdhac2 deficient mice exhibit a lack of forebrain 5-HT arbors and severe clumping of remaining arbors, thus raising a functional link to Lmx1b and Pet1.

Figure 9 with 1 supplement see all
An ascending specific Lmx1b→Pet1 cascade controls stage specific 5-HT gene expression and postnatal terminal arborization.

(A) RT-qPCR analysis of Pet1 expression in flow sorted TdTomato+ neurons 4 weeks post P3 tamoxifen treatment (n = 3, iControl; n = 4, P3 Lmx1bicKO mice). Unpaired t-test with Welch's correction, *p<0.05. Data are represented as mean ± SEM. (B) Pet1 in situ hybridization in P3 targeted Lmx1bicKO mice. Scale bars, 100 µm. (C) Venn diagram showing overlap of rostral Lmx1b and Pet1 regulated genes and the axon-related gene dataset. Lmx1b rostral: genes controlled by Lmx1b in rostral 5-HT neurons; Pet1 rostral: genes controlled by Pet1 in rostral 5-HT neurons; Axon genes: Lmx1b regulated rostral and caudal axon-related genes. (D) Relative expression of the unique Pcdhac2 exon in rostral Lmx1bcKO and Pet1cKO 5-HT neurons. * indicates FDR ≤ 0.05. Data are represented as mean ± SEM. (E) Developmental expression profile of Pcdhac2 in 5-HT neurons from E11.5 to early postnatal (PN). * indicates FDR ≤ 0.05. Data are represented as mean ± SEM. (F) Pcdhac2 in situ hybridization at postnatal day 14 in P3 targeted Lmx1bicKO mice. Representative image from n = 3 mice/genotype. Scale bars, 100 µm. (G) Pcdhac2 in situ hybridization at postnatal day 14 in P3 targeted Pet1icKO mice. ISH experiments done in parallel, iControl section is the same section in (F) and (G) to compare icKOs at the same tissue level. Representative image from n = 3 Pet1icKO mice. Scale bars, 100 µm. (H) Visualization of the Pcdhac2 gene locus showing mycPet1 ChIP peaks at the TSS and 3rd intron (shaded) and matches to the known Pet1 motif. Zoomed regions of the significant mycPet1 binding sites are shown at the bottom. (I) The mycPet1 binding region located within the 3rd Pcdhac2 intron DNAse I hypersensitivity site (HS7) contains a significant match to the known Pet1 position-weight matrix. TOMTOM q-value = 4.75×10−04. (J) Decreased TdTomato+ arbors detected in P3 targeted Pet1icKO hippocampus compared to iControl mice. Scale bars, 200 µm. (K) Decreased TdTomato+ arbors detected in all layers of P3 targeted Pet1icKO cortex (Imaris tracing; right panels) compared to iControl mice. Scale bars, 50 µm. (L) Decreased TdTomato+ arbors in striatum of P5 targeted Pet1icKO mice. Scale bars, 20 µm. See also Figure 9—figure supplement 1F.

https://doi.org/10.7554/eLife.48788.018

Since Pcdhac2 is in the Pcdh alpha gene cluster and shares 3 (out of 4) exons with all other Pcdh alpha genes, we performed differential exon expression analysis with the Lmx1b and Pet1 RNA-seq datasets. By testing the only unique exon for Pcdhac2, we found that Pcdhac2 was significantly regulated by Lmx1b and Pet1 at E17.5 (Figure 9D). In contrast, Pcdhac2 expression was not significantly regulated by Pet1 at earlier stages (Wyler et al., 2016). Furthermore, our time-series RNA-seq analyses (Wyler et al., 2016) showed a significant and dramatic upregulation of Pcdhac2 only at the onset of the arborization stage (Figure 9E). Thus, Pcdhac2 expression is precisely controlled at the stage in which it is required for morphological maturation of 5-HT neurons.

To determine whether Lmx1b was required to control the postnatal upregulation of Pcdhac2, we treated Lmx1bicKO mice with tamoxifen at postnatal day three and analyzed Pcdhac2 expression by ISH at P14, when arborization is profusely developing. Indeed, we found substantially reduced expression of Pcdhac2 in P3 Lmx1bicKO mice (Figure 9F). To further probe whether the Lmx1b→Pet1 regulatory cascade is required for upregulation of Pcdhac2 during arborization, we generated Pet1icKO (Pet1fl/fl; Tph2-CreER; Ai9) mice. We first verified that Pet1 was effectively targeted in P3 Pet1icKO mice by RT-qPCR of flow sorted TdTomato+ cells as well as ISH for Pet1 (Figure 9—figure supplement 1A,B). We confirmed that similar numbers of TdTomato+ neurons were activated in P3 Pet1icKO mice (Figure 9—figure supplement 1C,D) and that long-range routes were filled compared to controls (Figure 9—figure supplement 1E). We found that Pet1 did not regulate Lmx1b at this stage (Figure 9—figure supplement 1A). Interestingly, we found that Pet1 was also required for the dramatic postnatal upregulation of Pcdhac2 expression (Figure 9G). These findings show that the Lmx1b→Pet1 regulatory cascade acts during the arborization stage to temporally control Pcdhac2 upregulation.

To determine if Pcdhac2 is a direct target of Lmx1b→Pet1, we analyzed our previously published ChIP-seq datasets (Wyler et al., 2016) for mycPet1 binding sites within the Pcdhac2 locus. Notably, we identified only two significant mycPet1 ChIP-seq peaks throughout the entire 250 kb Pcdha locus (Figure 9H). One peak was located at the 5’ end of the unique Pcdhac2 first exon. The second peak was located precisely within the third-intronic DNase I hypersensitivity site, HS7, which marks a well characterized transcriptional enhancer known to regulate midbrain expression of the Pcdha gene isoform (Kehayova et al., 2011; Ribich et al., 2006) (Figure 9H). Although the mycPet1 peak at the TSS of Pcdhac2 does not contain a match to the known Pet1 binding motif, the second peak within HS7 does contain a significant match to the Pet1 motif (Wei et al., 2010) (Figure 9I).

To determine whether Lmx1b→Pet1 cascade acts postnatally to control terminal arborization we analyzed the forebrains of P3 targeted Pet1icKO mice. Analyses performed at P49 revealed a severe deficit of 5-HT arbors in the hippocampus and cortex of P3 targeted Pet1icKO mice, comparable to the deficit found in P3 targeted Lmx1bicKO mice (Figures 5C5DFigures 9J9K). The timing of 5-HT terminal arborization varies widely in different regions of the early postnatal forebrain (Lidov and Molliver, 1982; Maddaloni et al., 2017). Thus, we next sought to determine whether the Lmx1b→Pet1 cascade continues to control arborization in forebrain regions that are late to develop their mature axon patterns. To investigate this, we administered a single dose of tamoxifen to Pet1icKO pups at P5. We focused our subsequent analyses on the striatum, which is one of last regions of the forebrain to develop mature 5-HT arborization patterns (Lidov and Molliver, 1982). Interestingly, we found a notable deficit in the 5-HT arbors throughout the striatum (Figure 9L; Figure 9—figure supplement 1F). Together, our findings demonstrate that the Lmx1b→Pet1 cascade operates continually over an extended postnatal period to control stage-specific gene expression and to generate both early and late 5-HT terminal arbors patterns in different forebrain regions.

Discussion

The process of long-range axon pathway formation occurs in temporally defined stages over an extended period during which successive morphological events occur (Fame et al., 2011; Lidov and Molliver, 1982; Shirasaki and Pfaff, 2002). Many regulatory factors have been implicated in the intrinsic control (Santiago and Bashaw, 2014) of axon outgrowth, target selection, and terminal arborization (Arlotta et al., 2005; Chen et al., 2005; Galazo et al., 2016; Livet et al., 2002; Srivatsa et al., 2015). What is not understood are the intrinsic programs that operate temporally to progressively control the prolonged, multistage process of long-range axon projection pathway formation (Paolino et al., 2018). Our findings uncover a temporal regulatory strategy through which a continuously expressed transcription factor, Lmx1b, operates at successive stages to control progressive steps in the postmitotic morphological maturation of long-range highly diffuse axonal projection pathways. Thus, Lmx1b through its continuous expression not only controls the capacity for 5-HT synthesis and reuptake (Zhao et al., 2006), but also the formation of long range profusely arborized projection pathways that enable delivery of the transmitter throughout the CNS.

Our findings suggest Lmx1b acts to successively control 5-HT axon primary outgrowth, selective routing, and terminal arborization. We uncovered a delay in primary 5-HT axon outgrowth between E16.5 to E18.5 in Lmx1bcKO mice. However, initiation of primary axon outgrowth toward the forebrain or spinal cord was not disrupted in either Lmx1bcKO, Pet1cKO, or Pet1-/- mice. As 5-HT axonogenesis occurs concomitant with the onset of 5-HT synthesis in newborn 5-HT neurons (Hawthorne et al., 2010), perhaps upstream regulatory programs operating at the progenitor stage control initial axon outgrowth from newborn 5-HT neurons (Briscoe et al., 1999; Jacob et al., 2007; Pattyn et al., 2004).

The profound defect in the subsequent selective 5-HT axon routing through the cingulum, SCS, and fornix suggests a failure of intrinsic growth extension beyond selective routing choice points. In support of this, we never observed ectopic 5-HT axon trajectories. Yet, we leave open the possibility that axon guidance defects contribute to the failure of 5-HT axons to selectively extend through proper routes. 5-HT axons normally turn dorsally through the septal area at E18.5, which might constitute a critical choice point in building expansive axon 5-HT architectures. In contrast, the vast majority of mutant 5-HT axons fail to make the dorsal turn and then fail to continue into selective tracts. In support of a possible guidance defect, our RNA-seq studies indicated that Lmx1b controls expression of a large number of genes encoding guidance receptors, guidance receptor ligands, and adhesion molecules.

Transcription factors function within GRNs as elucidated in the specification and differentiation of various types of neurons (Deneris and Gaspar, 2018; Guillemot, 2007; Shirasaki and Pfaff, 2002). How transcription factors temporally interact within networks to progressively generate precise connectivity patterns is poorly understood (Paolino et al., 2018). A focus of our experiments was to determine whether Lmx1b functions in the context of the 5-HT GRN to control progressive development of 5-HT axonal pathways. We uncovered a temporal requirement for Lmx1b in maintaining Pet1 expression during the early postnatal stage of 5-HT pathway formation. This finding together with postnatal temporal targeting of Pet1 revealed the Lmx1b→Pet1 regulatory cascade acts stage specifically to control selective pathway routing and arborization of forebrain 5-HT axons. Despite the requirement for Pet1 in the acquisition of medullary 5-HT neuron-type identity (Hendricks et al., 2003; Kiyasova et al., 2011), it was surprising to find that Pet1 was not required for routing and arborization of descending 5-HT axons, thus revealing distinct transcription factor requirements in the generation of ascending and descending 5-HT axon pathways. Perhaps, Lmx1b operates with other continuously expressed serotonergic transcription factors in a regulatory cascade to control descending 5-HT axonal pathways. Gata3 is an interesting candidate as it functions more prominently in the medullary 5-HT neurons that generate the descending subsystem than 5-HT neurons that give rise to the ascending subsystem (Pattyn et al., 2004; van Doorninck et al., 1999).

The hundreds of axon related genes controlled by Lmx1b in the ascending and descending subsystems suggests that mis-expression of scores of functionally diverse effector genes accounts for the axon pathway defects we have reported. One gene of note is Gap43. Telencephalic commissures of Gap43 null mice fail to form, including the hippocampal commissure and the corpus callosum (Shen et al., 2002). This may largely explain the 5-HT neuron axonal projection deficits reported in the Gap43 null forebrain (Donovan et al., 2002). Although Gap43 is expressed in 5-HT neurons, it is not yet known whether it plays an intrinsic role in 5-HT axon development (Bendotti et al., 1991). Our findings highlight the potential importance of an intrinsic Lmx1b→Pet1→Gap43→5-HT axon regulatory path given that Gap43 expression is reduced in both Lmx1bcKO and Pet1cKO mice. It will be interesting to investigate this putative path in 5-HT conditionally targeted Gap43 mice to determine whether it accounts for the selective routing defects present in Lmx1bcKO and Pet1cKO mice.

The stage specific regulatory roles we have uncovered suggests Lmx1b may temporally control certain genes to fulfill stage-specific events in the morphological maturation of 5-HT neurons. In support of this idea, our findings reveal that Pcdhac2, a key intrinsic effector of 5-HT terminal arbor growth and patterning (Chen et al., 2017; Katori et al., 2009; Katori et al., 2017), is dynamically regulated by the ascending Lmx1b→Pet1 cascade. Tamoxifen-inducible targeting of Lmx1b and Pet1 revealed a temporal requirement for Lmx1b and Pet1 in the postnatal upregulation of Pcdhac2. Notably, our ChIP-seq datasets revealed Pet1 occupancy at the Pcdhac2-specific promoter and HS7 suggesting Lmx1b→Pet1 directly controls upregulation of Pcdhac2 during the postnatal arborization stage. Perhaps Pet1 occupancy at HS7 facilitates cohesin-mediated looping from HS7 to the Pcdhac2 promoter thus accounting for Pet1 occupancy at this promoter in the absence of a high affinity Pet1 binding motif (Guo et al., 2012).

Deficient expression of a single stage-specifically expressed target gene such as Pcdhac2 likely does not account for the severe and complex multi-stage defects in long-range 5-HT axon pathway formation reported here. However, our studies do serve to illustrate the concept that Lmx1b and Pet1 are critical terminal selectors of neuronal morphology and likely do so by dynamically regulating downstream genes that are required at specific stages for the progressive morphological maturation of 5-HT neurons. Perhaps subsets of Lmx1b controlled genes act in different 5-HT neuron subtypes and at distinct stages to control the specific routes of 5-HT axons to diverse forebrain and spinal cord targets.

We speculate that our findings illustrate a possible general mechanism through which continuously expressed terminal selectors build long-range diffuse axon pathways. In addition to 5-HT neurons, noradrenergic, dopaminergic, and histaminergic neurons also generate expansive and highly arborized axonal architectures (Björklund and Dunnett, 2007; Haas et al., 2008; Moore and Bloom, 1979). Lmx1b plays a critical role in dopaminergic (DA) neuron development. However, in contrast to 5-HT neurons, Lmx1b is co-expressed in postmitotic DA neurons with its paralog, Lmx1a, up to about 2 months of age (Laguna et al., 2015). These two LIM HD factors play compensatory roles in mesDA neuron specification and differentiation (Laguna et al., 2015; Yan et al., 2011). Simultaneous DA targeting of Lmx1a and Lmx1b beginning at E14 resulted in diminished DA axon outgrowth to the dorsal striatum while DA axon projections to the ventral striatum and other DA axon targets throughout the forebrain remained intact (Chabrat et al., 2017). These findings suggest that temporal control of axon routing and arborization of the DA mesostriatal, mesolimbic and mesocortical projection pathways may be controlled by different continuously acting terminal selector transcription factors expressed in DA neurons.

In addition to their tremendous intrinsic capacity for long-range axonal growth and arborization during development, 5-HT neurons are noted for their rare ability to sprout and regenerate axons after injury (Hawthorne et al., 2011; Jin et al., 2016). Given Lmx1b’s continuous expression into adulthood and crucial function in the formation of 5-HT projection pathways an intriguing line of investigation will be to determine whether Lmx1b transcriptionally powers 5-HT neuron’s intrinsic potential for axon regrowth following injury in adult brain or spinal cord, which may suggest ways to harness that power for development of new repair strategies.

Materials and methods

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (Mus musculus)Lmx1bNAMGI:1100513
Gene (M. musculus)Pet1NAMGI:2449712
Gene (M. musculus)Tph2NAMGI:2651811
Genetic reagent (M. musculus)Pet1-CrePMID:16251278RRID:MGI:4837211Evan Deneris (Case Western Reserve University)
Genetic reagent (M. musculus)RosaTomJackson LaboratoryStock #: 007909; RRID:MGI:4436851Hongkui Zeng (Allen Institute for Brain Science)
Genetic reagent (M. musculus)Tph2-CreERT2Jackson LaboratoryStock #: 016584; RRID:IMSR_JAX:016584Bernd Gloss (NIEHS)
Genetic reagent (M. musculus)Lmx1bfloxPMID:17151281RRID:MGI:3810753Zhou-Feng Chen (Washington University)
Genetic reagent (M. musculus)Pet1floxPMID:20818386RRID:MGI:4837213Evan Deneris (Case Western Reserve University)
Genetic reagent (M. musculus)Tph2floxPMID:24972638RRID:IMSR_JAX:027590Zhou-Feng Chen (Washington University)
Genetic reagent (M. musculus)Pet1-/-PMID:12546819MGI:2449922Evan Deneris (Case Western Reserve University)
Genetic reagent (M. musculus)Pet1-YFPPMID:16251278n/aEvan Deneris (Case Western Reserve University)
Antibodyanti-RFP (rabbit polyclonal)RocklandRockland: p/n 600-401-379; RRID:AB_2209751(1:200)
Antibodyanti-GFP (rabbit polyclonal)InvitrogenInvitrogen: A6455; RRID:AB_221570(1:200)
Antibodyanti-5-HT (rabbit polyclonal)ImmunostarImmunostar: 20080; RRID:AB_1624670(1:200)
Antibodyanti-Tph2 (rabbit polyclonal)MilliporeMillipore: ABN60; RRID:AB_10806898(1:500)
Antibodyanti-Lmx1b (rabbit polyclonal)Suleiman et al., 2007-giftn/a(1:200)
Antibodyanti-RFP (mouse monoclonal)AbcamAbcam: ab65856; RRID:AB_1141717(1:200)
Antibodyanti-RFP (mouse monoclonal)RocklandRockland: p/n 200-301-379; RRID:AB_2611063(1:200)
AntibodyAlexa 488- or 594- secondariesInvitrogen(1:500)
Genetic reagent (Virus)rAAv2/Ef1a-DIO-hchR2 (H134R)-EYFPUNC GTC Vector CoreLot# AV4378K
Sequence-based reagentPcdhac2 in situ primer: F: 5’ AGCCACCTCTATCAGCTACCG 3’this paper
Sequence-based reagentPcdhac2 in situ primer: R: 5’ AGAATTAACCCTCACTAAAGGGCTCATTTTGAGAGCCAGCATCA 3’this paper
Sequence-based reagentPet1 in situ primers: F:5’CCAGTGACCAATCCCATCCTC3’PMID:26843655
Commercial assay or kitTranscriptor First Strand cDNA Synthesis KitRocheREF 4896866001
Commercial assay or kitPerfeCTa PreAmp SuperMixQuantoBioCat. No. 95146–040
Commercial assay or kitPerfeCTa FastMix II ROX mastermixQuantaBioCat. No. 95119–012
Commercial assay or kitRNA Clean and ConcentratorTM-5 kitZymo ResearchCatalog Nos. R1015 and R1016
Chemical compound, drugTamoxifenSigma-AldrichCAS Number: 10540-29-110 mg/mL stock in corn oil
Other35 μm filterBD biosciencesCat. No. 352235
OtherFetal bovine serum (FBS)GibcoCat. No. 16000044
OtherDNase IInvitrogenCat. No. 18047019
OtherTrizol LSInvitrogenCat. No. 10296010
OtherTrypLEInvitrogenCat. No. 12605010
OtherLeibovitz’s L15 mediumInvitrogenCat. No. 11415114
Commercial assay or kitQuantifluor RNA systemPromegaCat. No. E3310
Commercial assay or kitNugen TRIO RNA-seqNugenCat. No. 0507–08
Commercial assay or kitZymo RNA clean and concentratorZymo ResearchCat. No. R1013
OtherFACS Aria IBecton Dickinson
OtheriCyt cell sorterSony
OtherFragment analyzerAdvanced Analytics
OtherNextseq 550IlluminaRRID:SCR_016381
Software, algorithmFASTQChttps://www.bioinformatics.babraham.ac.uk/projects/fastqc/RRID:SCR_014583
Software, algorithmTrimmomaticBolger et al., 2014RRID:SCR_011848
Software, algorithmCufflinks (v2.2.2)Trapnell et al., 2010RRID:SCR_014597
Software, algorithmR (v. 3.5)http://www.r-project.orgRRID:SCR_001905
Software, algorithmWebgestalthttp://www.webgestalt.orgRRID:SCR_006786
Software, algorithmBiovennhttp://www.biovenn.nl
Software, algorithmDEXSeqAnders et al., 2012RRID:SCR_012823
Software, algorithmTophat2 (v2.1.1)Kim et al., 2013RRID:SCR_013035
OtherMus musculus genomeEnsembl, v. 96RRID:SCR_002344
OtherMus musculus genomeUCSC, mm10RRID:SCR_005780
Software, algorithmfeatureCountsRsubreadRRID:SCR_012919
Software, algorithmENCODE Transcription Factor ChIP-seq analysis pipelinehttps://github.com/ENCODE-DCC/chip-seq-pipelineRRID:SCR_015482
Software, algorithmBurroughs-Wheeler aligner (BWA)http://bio-bwa.sourceforge.net/RRID:SCR_010910
Software, algorithmMACS2Zhang et al., 2008RRID:SCR_013291
Software, algorithmImaris 7.4.2Bitplane, Zurich, SwitzerlandSurfaces or Filament Tracer tool

Animals

Request a detailed protocol

All procedures were approved by the Institutional Animal Care and Use Committees of Case Western Reserve University in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Experiments were performed on male and female mice using age-matched and sex-matched controls in triplicate unless otherwise noted. Adult mice between the ages 2.5 to 3.5 months were used unless otherwise noted. Early conditional knockout mice (designated Lmx1bcKO, Pet1cKO, and Tph2cKO) were generated by using the following genetic mouse lines: Pet1-Cre (original name ePet-Cre) (Scott et al., 2005), Ai9 Rosa TdTomato (RosaTom; Jackson labs) and either Lmx1bfl (Zhao et al., 2006), Pet1fl (Liu et al., 2010), or Tph2fl (Kim et al., 2014). All early conditional knockout mice were compared to non-floxed controls (+/+;Pet1-Cre;Ai9). The following genetic lines were used to generate Lmx1bicKO or Pet1icKO mice for postnatal stage conditional knockout: Tph2-CreERT2 (Jackson lab), Ai9 Rosa TdTomato (RosaTom; Jackson lab) and either Lmx1bfl (Zhao et al., 2006) or Pet1fl (Liu et al., 2010). All postnatal stage conditional knockout mice were compared to non-floxed controls (iControls: +/+;Tph2-CreER; Ai9). Pet1-/- mice (Hendricks et al., 2003) carrying the Pet1-YFP transgene (Scott et al., 2005) were used for embryo studies at E13.5. Tail or ear genomic DNA was used to determine genotypes of all animals. All mice were housed in ventilated cages on a 12 hr light/dark cycles with access to food and water with 2–5 mice per cage.

Embryos and postnatal pups

Request a detailed protocol

All embryo experiments at each time point were performed in triplicate unless otherwise noted and compared to littermate controls (Lmx1bfl/+ vs Lmx1bfl/fl; Pet1fl/+ vs Pet1fl/fl; Pet1+/- vs Pet1-/-). Both male and female littermates were used for analysis. Embryonic day 0.5 (E0.5) was determined by presence of a vaginal plug. Postnatal day 0 (P0) was designated by date of birth.

Histology and immunohistochemistry

Request a detailed protocol

Adult mice were anesthetized with Avertin (44 mM tribromoethanol, 2.5% tert-amyl alcohol, 0.02 ml/g body weight) and perfused for 2–3 min with cold PBS followed by 20 min cold 4% paraformaldehyde (PFA) in PBS. Brains and/or spinal cords were removed, post-fixed in 4%PFA for 2 hr and placed in 30% sucrose/PBS overnight (O/N) for cryoprotection. E12-E13 embryos were drop fixed in 4% PFA in PBS O/N followed by 30% sucrose incubation O/N. All embryos between age E15-E18 were transcardially perfused with 5 mL of 4% PFA in PBS, incubated in 4% PFA in PBS O/N, and incubated in 30% sucrose O/N. All tissue collected was frozen in Optimal Cutting Temperature (OCT) solution and sectioned on a cryostat at 25 µm. Tissue sections were mounted on SuperFrost Plus slides (Thermo Fisher Scientific) and vacuum dried. Sections were then permeabilized in 0.3% Triton 100X-PBS (PBS-T) for 15 min followed by antigen retrieval in Sodium Citrate buffer for 5 min in the microwave at low power. Sections were blocked with 10% NGS in PBS-T for 1 hr followed by incubation in primary antibody using a rabbit anti-RFP antibody (1:200; p/n 600-401-379, Rockland) at 4 °C O/N. Antigen retrieval step was not used for the following primary antibodies: rabbit anti-GFP (1:200; A6455, Invitrogen), rabbit anti-5-HT (1:200; Immunostar), rabbit anti-Tph2 (1:500; ABN60, Millipore), and rabbit anti-Lmx1b (1:200; Suleiman et al., 2007). For all co-stains with TdTomato a mouse anti-RFP (1:200; ab65856, Abcam) or a mouse anti-RFP (1:200; p/n 200-301-379, Rockland) primary antibody was used. Secondary antibodies were used at 1:500; goat anti-rabbit or mouse, Alexa Fluor 594 or 488 (Invitrogen).

In situ hybridization

Request a detailed protocol

In situ hybridization was performed using a standard protocol using a digoxigen-11-UTP labeled antisense RNA probe to detect Pet1 and Pcdhac2 (Roche diagnostics) as described elsewhere (Wyler et al., 2016). Pcdhac2 probe (566 bp) was generated using the following primers: F: 5’ AGCCACCTCTATCAGCTACCG 3’ and R: 5’ AGAATTAACCCTCACTAAAGGGCTCATTTTGAGAGCCAGCATCA 3’. Pet1 probe (513 bp) was generated using primers: F:5’CCAGTGACCAATCCCATCCTC3’ and R: 5’AGAATTAACCCTCACTAAAGGGTTAATGGGGCTGAAAGGGATA3’.

Cell counts

Request a detailed protocol

5-HT neurons were identified by Tph2 immunostaining. To calculate the Pet1-Cre efficiency, every 4th section was taken through the entire rostrocaudal extent of the DRN/MRN/B9 and medullary areas of control mice (n = 2 control mice) and RFP+/TPH2+ and TPH2+/RFP+ ratios were calculated. Tph2-CreER efficiency in postnatal tamoxifen injected pups was calculated from sections taken through the entire rostrocaudal extent of the DRN/MRN/B9 and expressed as a ratio of RFP+/TPH2+ and TPH2+/RFP+ cells (n = 4 iControl mice). A computer program that permits blinded manual cell counting was used (Fox and Deneris, 2012) to determine numbers of TdTomato+ cells between control vs Lmx1bcKO, control vs Tph2cKO, and iControl vs Lmx1bicKO or Pet1icKO mice. Every 4th matched section was counted through the entire rostrocaudal extent of the DRN/MRN/B9 or medullary 5-HT system as described. To calculate the percentage of remaining Tph2+ neurons in Lmx1bcKO vs Tph2cKO mice, Tph2+ neurons were counted in every 4th section throughout the DRN/MRN/B9. Tph2+ cell numbers in cKO animals was normalized to the number of Tph2+ cells in control matched sections and expressed as a percentage for each genotype comparison.

Tamoxifen injections

Request a detailed protocol

P1 pups (Lmx1bfl/fl;Tph2-CreER;Ai9 and iControls; n = 4 mice/genotype) were injected 1X with 100 µg of tamoxifen (10 mg/mL stock in corn oil). P3 or P5 pups (P3: Lmx1bfl/fl;Tph2-CreER;Ai9, Pet1fl/fl;Tph2-CreER;Ai9, and iControls; n = 3 mice/genotype; P5: Pet1fl/fl;Tph2-CreER;Ai9 and iControls, n = 2 mice/genotype) were injected 1X with 200 µg tamoxifen. All tamoxifen injections were performed subcutaneously at the back of the neck using a 30-gauge needle on a 1 mL syringe. Pups were allowed to sit for a few minutes before returning to mother. Injected mice were taken at either 31 or 49 days of age for analysis as indicated.

Viral injections

Request a detailed protocol

Adult animals (Lmx1bfl/fl;Pet1-Cre;Ai9 and Lmx1b+/+;Pet1-Cre;Ai9; n = 2 mice/genotype) were anesthetized with Isoflurane and stereotaxically injected unilaterally at two sites with 1.5 µl and 1 µl rAAv2/Ef1a-DIO-hchR2 (H134R)-EYFP (UNC GTC Vector Core Lot# AV4378K) at X = 0.6 mm, Y = −4.2 mm, Z = −3.2 mm and X = 0.6 mm, Y = −4.2 mm, Z = −4.2 mm relative to Bregma respectively. Animals were treated with a local anesthetic (bupivacaine HCL; Hospira) administered subcutaneously prior to surgery and with analgesic (carprofen 5 mg/Kg; Pfizer) for 3 days following. Holes were drilled through the skull to expose brain, following which a Hamilton syringe was slowly lowered to desired coordinates. Infusion rate was set to 0.1 µl/min with 10 min after each injection to allow diffusion of virus. Animals were returned to group housing following recovery and sacrificed 10 weeks after surgery.

5-HT neuron dissociation and flow cytometry

Request a detailed protocol

For RNAseq analyses rostral and caudal E17.5 YFP+ 5-HT neurons were collected from Lmx1bfl/fl;Pet1-EYFP or Pet1fl/fl;Pet1-EYFP (controls) and Lmx1bfl/fl;Pet1-EYFP;Pet1-Cre or Pet1fl/fl;Pet1-EYFP;Pet1-Cre (Lmx1bcKO or Pet1cKO) mice using flow cytometry. To dissociate embryonic 5-HT neurons, hindbrains were initially dissected to separate rostral 5-HT neurons from caudal 5-HT neurons in cold PBS. Tissue was transferred to 1.5 mL ependorf tubes and centrifuged at 1500 rpm for 1 min at 4 °C. PBS was removed and 500 µL 1X TrypLE Express (Gibco) was added to the tissue and incubated at 37 °C for 15 min followed by addition of L-15 media (Gibco). Samples were centrifuged for 1 min at 1500 rpm and washed 3X with PBS. Tissue was then resuspended in 500 µL L15/0.1%BSA/DNase solution and slowly triturated 30X with fire-polished Pasteur pipettes of decreasing bore size until fully suspended. Samples were then filtered, and flow sorted on a FACS Aria I or Sony iCyt cell sorter.

Postnatal 5-HT neuron dissociation was performed in either P2 Lmx1bcKO or 4 week old Lmx1bicKO or Pet1icKO mice. Brains were sliced at 400 µm on a vibratome (Pelco easiSlicer) in continuously bubbling (95%O2; 5%CO2) aCSF solution (3.5 mM KCl, 126 mM NaCl, 20 mM NaHCO3, 20 mM Dextrose, 1.25 mM NaH2PO4, 2 mM CaCl2, 2 mM MgCl2, 50 μm AP-V (Tocris), 20 μm DNQX (Sigma), and 100 nM TTX (Abcam)). Sections containing rostral 5-HT neurons were incubated in 1 mg/mL Protease from Streptomyces griseus (Sigma; P8811) in bubbling aCSF solution for 30min (P2 mice) or 45min (4-week-old mice) at room temperature. Slices were then incubated for 15min in bubbling aCSF alone at RT. TdTomato+ neurons were microdissected from slices in cold aCSF/10%FBS solution. Samples were slowly triturated 30-100X with fire-polished Pasteur pipettes of decreasing bore size until fully suspended. Samples were then filtered, and flow sorted on a FACS ARIA-SORP sorter.

RNA sequencing

Request a detailed protocol

Total RNA was isolated from flow-sorted neurons using Trizol LS (Invitrogen) and the RNA Clean and Concentrator-5 kit (Zymo Research). RNA concentration and quality was determined using Quantifluor RNA system (Promega) and Fragment analyzer (Advanced Analytics). Samples were converted to cDNA, depleted of rRNA transcripts, and amplified using the TRIO RNA-seq kit for mouse (Nugen Inc). Single-end sequencing was performed on a Nextseq 550 (Illumina) for 76 cycles. Read quality was assessed using FASTQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and adapters were trimmed using Trimmomatic (Bolger et al., 2014). Filtered and trimmed reads were aligned to the mouse genome (mm10, UCSC) using Tophat2 (v2.1.1) (Kim et al., 2013).

RNA sequencing analysis

Request a detailed protocol

Gene expression quantification and differential expression were analyzed using Cufflinks v2.2.2 (Trapnell et al., 2010). In all differential expression comparisons, a gene was called differentially expressed if fold-change was ≥1.5 and false discovery rate (FDR) was ≤5%. Hierarchical clustering of differentially expressed genes in rostral Lmx1bcKO and caudal Lmx1bcKO samples was performed in R (v. 3.5) using row-scaled values with Euclidean distance and complete linkage. The heatmap was plotted with the gplots library. Gene Ontology analysis was performed using Webgestalt (http://www.webgestalt.org), requiring five genes per category and FDR ≤ 5%. Venn diagrams were generated using Biovenn (http://www.biovenn.nl) (Hulsen et al., 2008; Wang et al., 2017). Differential exon expression analysis was performed to test for differences of the unique Pcdhac2 first exon with DEXSeq (Anders et al., 2012). RNA-seq reads were mapped to the Mus musculus genome (Ensembl, v. 96) and reads falling within annotated exons were counted using featureCounts (Rsubread). DEXSeq default settings were used and significant exon usage differences were determined at FDR ≤ 5%.

qPCR

Request a detailed protocol

RNA was isolated from YFP+ flow sorted cells in Trizol LS (Invitrogen) using chloroform extraction followed by the RNA Clean and Concentrator-5 kit (Zymo Research). cDNA was then synthesized using equal input RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche). cDNA was then amplified (8 PCR cycles) using PerfeCTa PreAmp SuperMix (QuantoBio) followed by ExoI digest to remove excess primers. RT-qPCR was performed using PerfeCTa FastMix II ROX mastermix (QuantaBio) with TaqMan probes (Thermofisher Scientific).

Chromatin immunoprecipitation analysis

Request a detailed protocol

ChIP-seq data for mycPet1 was obtained from Wyler et al. (2016). The data was re-analyzed using the ENCODE Transcription Factor ChIP-seq analysis pipeline (https://github.com/ENCODE-DCC/chip-seq-pipeline). Reads were mapped to the Mus musculus genome (UCSC mm10) using the Burroughs-Wheeler aligner (BWA) and peaks were called with MACS2 with FDR ≤ 1% (Zhang et al., 2008).

Axon quantification

Request a detailed protocol

Spinal cord: Coronal sections of spinal cords were taken at 25 µm. Two sections were taken blindly from each cervical and lumbar spinal segment from each genotype (n = 3, control; n = 3, Lmx1bcKO mice) and (n = 3, control; n = 3, Pet1cKO). Whole gray area or whole white matter area was selected independently, and pixels were quantified using Zeiss 2.3 Image Analysis module. Pixel values were normalized to selected area (µm2) for each section. Two-way ANOVA with Welch’s correction analysis was performed. p values for each comparison are detailed in Fig. Legends.

Forebrain: Coronal sections of hippocampus, cortex, and axon tracts (SCS and cingulum) were taken and TdTomato+ pixels were quantified using Zeiss 2.3 Image Analysis module in P3 targeted iControls (n = 3 non-littermate mice) and P3 Lmx1bicKO mice (n = 3 non-littermate mice). Pixel values were normalized to selected area (µm2). Unpaired t-test with Welch's correction statistical analysis was performed. p values for each comparison are detailed in Fig. Legends.

Cell volume analysis

Request a detailed protocol

Thick tissue sections were sliced at 150 µm and cleared using CUBIC clearing technique to increase the optical transparency of sections (Susaki et al., 2015). CUBIC reagent was prepared using urea (25 wt% final concentration), Quadrol (25 wt% final concentration), Triton X-100 (15 wt% final concentration) and dH2O. Tissue sections were incubated in CUBIC reagent at 4°C overnight. To avoid the distortion of tissue by compression of the glass cover slip, Blu-Tack reusable adhesive was used to create a reservoir with a 0.3–0.5 mm depth. The transferred tissue sections were then sealed in CUBIC reagent using a glass cover slip for z-stack confocal imaging of the endogenous TdTomato fluorescence of cell bodies. The 3D neuron images were reconstructed and measured using the Surfaces or Filament Tracer tool in Imaris 7.4.2 (Bitplane, Zurich, Switzerland). Unpaired t-test with Welch's correction statistical analysis was performed. Sample size and p values for each comparison are detailed in Fig. Legends.

Image acquisition and processing

Request a detailed protocol

Immuno-stained slides were imaged on an LSM800 confocal microscope (Carl Zeiss). All embryonic forebrain images were captured using a BZ-X700 fluorescence microscope (Keyence) or Olympus Optical BX51 microscope. Global brightness and contrast were edited across whole images equally between genotypes. Whole sagittal sections (Figure 1A,B) were acquired using confocal 10X objective and both control and Lmx1bcKO sections were processed in ImageJ and subjected to equal background subtraction followed by Lookup Table-Fire to enhance visualization of TdTomato+ axon intensities in the forebrain. Axon tracing in Figure 5D and Figure 9K was performed using the Filament Tracer module in Imaris 7.4.2 (Bitplane, Zurich, Switzerland).

Accession codes

Request a detailed protocol

All data generated in this study are deposited in NCBI GEO under accession code GSE130514.

Data availability

Raw ChIP-seq data GEO accession: GSE74315. RNA-seq data generated in this study and ChIP-seq analysis are deposited in NCBI GEO under accession code GSE130514.

The following data sets were generated
    1. Donovan LJ
    2. Spencer WC
    3. Kitt MM
    4. Eastman BA
    5. Lobur KJ
    6. Jiao K
    7. Silver J
    8. Deneris ES
    (2019) NCBI Gene Expression Omnibus
    ID GSE130514. Lmx1b is required at multiple stages to build expansive serotonergic axon architectures.
The following previously published data sets were used
    1. Wyler SC
    2. Spencer WC
    3. Green NH
    4. Rood BD
    5. Crawford L
    6. Craige C
    7. Gresch P
    8. McMahon DG
    9. Beck SG
    10. Deneris ES
    (2016) NCBI Gene Expression Omnibus
    ID GSE74315. Pet-1 Switches Transcriptional Targets Postnatally to Regulate Maturation of Serotonin Neuron Excitability.

References

Decision letter

  1. Anne E West
    Reviewing Editor; Duke University School of Medicine, United States
  2. Eve Marder
    Senior Editor; Brandeis University, United States
  3. Patricia Gaspar
    Reviewer; INSERM, U839, Institut du Fer à Moulin, France

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Lmx1b is required at multiple stages to build expansive serotonergic axon architectures" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Eve Marder as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Patricia Gaspar (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

The transcription factor Lmx1b is known to be required for the expression of genes that underlie the serotonergic cell fate. However, this terminal fate selector transcription factor stays on even after the transmitter identify of these neurons is determined, leading the authors to ask whether it might also have other functions in the later stages of development of these cells, specifically their axonal arborization. To address this question, the authors use a conditional Lmx1b allele combined with different Cre strategies and the Ai9 reporter line to visualize and FACS isolate Lmx1b deficient neurons. In a nice series of experiments they show that not only embryonic (E12.5) but also postnatal (P1, P3) cell-type specific knockout of Lmx1b is sufficient to disrupt specific aspects of serotonergic axonal arborization. The authors then FACS sort cKO neurons for RNAseq and find a program of gene expression enriched for axonal growth categories that they believe contributes to Lmx1b-dependent axon arborization. They compare list against Pet1 cKO neurons and also a ChIP for myc-tagged Pet1 from an earlier study. They focus in a bit on one potential gene target that has previously been shown to affect axonal arborization, Pcdhac2. They validate the regulation of its expression at the time of 5HT neuron arborization and its dysregulation in the cKO neurons.

This is an interesting and very solid piece of work combining detailed anatomical descriptions in an impressive number of mouse mutants with a thorough genomic analysis that opens up the molecular mechanisms involved in the observed phenotypes. It makes the point that a given transcription factor can have very different roles and control different gene sets during cell specification and the maturation of the full axon arbors, which is an important part of a neuron's identity. Additionally, the paper provides a very useful resource on gene candidates that are potentially involved in serotonin neuron maturation during the early postnatal period. This is important considering the role of serotonin dysfunction in vulnerability to psychiatric disorders, and understanding what molecular mechanisms underlie the critical developmental period of this system.

Essential revisions:

1) The story would be more complete with some further mechanistic studies, though the reviewers agreed these were not required for publication of this story. Nonetheless we note here that reviewers suggested it would be interesting to know whether transgenic expression of Pcdhac2 was sufficient to rescue any of the mutant phenotypes, whether mutation of the Pet1 binding motif in the Pcdha enhancer would be sufficient to recapitulate the phenotypes, and whether more could be said about the ordering of the functions of Lhx1b versus Pet1 that could be derived from deeper analysis of the RNAseq data or a combination of the RNAseq and ChIP-seq data. If the authors have data or commentary on these points, it would add icing to the cake of a thorough study.

2) Figure 6 shows that 5-HT depletion Tph2-CKO has no effect on axon terminal distribution. One reviewer noted that this contradicts observations on a very similar mouse model by the Pasqualetti team. This reviewer also cited the recent paper of Pratelli et al., 2017, which showed that adult depletion of 5-HT had similar effects, which seemed a nice demonstration of the plasticity of this system. The possible reasons for this discrepancy are not discussed. Further, if possible, some quantification of the axon tract defects in the forebrain would add more strength to the description in this study.

3) Finally the reviewers raised a few points from the text that deserve revision or discussion:

– The statement that Lmx1 mutants have "axon primary outgrowth and selective routing defects " does not seem accurate. From the data provided, the outgrowth and routing of the serotonin raphe axons seem to be undisturbed during early embryonic stages and there are no clear abnormal trajectories later (at least in the data provided). This suggests that axon guidance and general axon targeting is overall normal, but that there is a stalling of growth along existing axon tracts- which starts to be visible at E16, there is also defective axon terminal branching with reduction in fiber density and aggregated axon terminals in some regions.

– To help integrate the new observations from this study into the larger literature on serotonin neuron development, the authors could provide a better perspective/discussion on how their phenotypes resemble or differ from the ones described in other mutants. For example, i) The phenotype of the Lmx1B seems to be a sort of mix of the Gap43 KO and of the Pcadhc2 -KO, which makes sense given the fact that they are both down-regulated. ii) The phenotype of developing serotonin axons in the forebrain Pet1 cKO (Figure 8) is very similar to that described by Kiyasova et al. in the full Pet1-KO.

– The normal morphology of the serotonin terminals in the PVT and intralaminar thalamic nuclei (Figure 8—figure supplement 1B) in the Pet1 cKO could support the notion that these are not misguided 5-HT axons, but serotonin axons with less dependence on Pet for growth, in a way similar to what they suggest for the spinal cord projections.

– The transcriptional analysis reveals more widespread transcriptional changes in the caudal group than in the rostral raphe group, whereas the axonal alterations seem to predominate in the rostral group. Do the authors have a suggestion as to why this may be the case?

https://doi.org/10.7554/eLife.48788.027

Author response

Essential revisions:

1) The story would be more complete with some further mechanistic studies, though the reviewers agreed these were not required for publication of this story. Nonetheless we note here that reviewers suggested it would be interesting to know whether transgenic expression of Pcdhac2 was sufficient to rescue any of the mutant phenotypes, whether mutation of the Pet1 binding motif in the Pcdha enhancer would be sufficient to recapitulate the phenotypes, and whether more could be said about the ordering of the functions of Lhx1b versus Pet1 that could be derived from deeper analysis of the RNAseq data or a combination of the RNAseq and ChIP-seq data. If the authors have data or commentary on these points, it would add icing to the cake of a thorough study.

Several previous studies have clearly demonstrated the critical intrinsic role for Pcdhac2 in 5-HT terminal arborization (Katori et al., 2009, Katori et al., 2017, and Chen et al., 2017). We utilized this thorough understanding of Pcdhac2 function to illustrate the idea that Lmx1b→Pet1 controls stage-specific expression of a gene that is required in a stage-specific manner for postnatal development of 5-HT axons.

Our RNA-seq studies suggest the 5-HT axon defects we report result from mis-expression of a large number of functionally diverse Lmx1b controlled growth and guidance effectors. The papers listed above and our analysis of Pcdhac2 regulation identify this gene as a key effector of 5-HT axon development and a direct downstream target of Lmx1b→Pet1. Our primary interest going forward is to identify less obvious direct effectors of the Lmx1b-directed 5-HT axonal growth program. The challenge is to conceive an efficient experimental approach to accomplish this objective. We have considered a transgenic approach for rescue but assert its low throughput (quadruple compound allelic mice) makes it impractical. Perhaps rescue via viral expression in tamoxifen treated Lmx1biCKO or Pet1iCKO mice would offer greater throughput. We are continuing to explore various rescue approaches.

We agree an interesting experiment is to determine whether mutation of Pet1 binding motifs in Pcdhac2 phenocopy 5-HT axon defects in Lmx1b or Pet1 targeted mice. We are currently discussing the optimal experimental design with which to edit Pet1 binding sites in the Pcdhac2 promoter and/or intronic enhancer and generate mutant mice for future in vivo studies.

We have discussed at length how a deeper analysis of the existing RNA-seq and ChIP-seq data might reveal more about the ordering of Lmx1b and Pet1 functions and do not believe further conclusions can be made. It is possible to analyze the data for the Lmx1b homeodomain sequence motif as a preliminary step to determine whether Lmx1b could directly bind to either Lmx1b-regulated or Pet1-regulated genes. This type of analysis is useful in certain circumstances, but certainly would not show definitive binding of Lmx1b to the regulated gene. Ideally, we would perform ChIP-seq for Lmx1b. However, a ChIP-grade Lmx1b antibody is not available. We are working to generate a custom rabbit polyclonal antibody to Lmx1b and will eventually test it for the ability to immunoprecipitate Lmx1b bound chromatin. In future studies, we will further evaluate the direct regulation of Lmx1b and Pet1 target genes identified in this study to determine the ordering of Lmx1b and Pet1 functions in controlling 5-HT neuron axon development.

2) Figure 6 shows that 5-HT depletion Tph2-CKO has no effect on axon terminal distribution. One reviewer noted that this contradicts observations on a very similar mouse model by the Pasqualetti team. This reviewer also cited the recent paper of Pratelli et al., 2017, which showed that adult depletion of 5-HT had similar effects, which seemed a nice demonstration of the plasticity of this system. The possible reasons for this discrepancy are not discussed.

There is no contradiction although we understand how this might be construed as one. We fully agree the Pasqualetti group has clearly shown that total elimination of brain 5-HT levels leads to alter development of 5-HT axons (Migliarini et al., 2013 and Pratelli et al., 2017). However, it is essential to note a key difference between our study and theirs: the Pasqualetti group generated eGFP-knock in mice into the Tph2 locus, which resulted in a complete loss of Tph2 expression. In contrast, our Tph2 targeting with the ePet-Cre driver led to a quantitative loss of Tph2 that was comparable to the loss of Tph2 in Lmx1b CKO mice (see Figure 6B-D). Our objective was to determine whether the reduced, but not total, loss of Tph2 expression in Lmx1bCKO mice accounts for some of the 5-HT axon defects reported in these mice. Thus, we generated Tph2 targeted mice with the ePet-Cre driver as used in Lmx1bCKO mice to achieve a comparably reduced level of Tph2 expression. As reported in Figure 6, we saw no axon defects in our Tph2 targeted mice. Our conclusion is that the 5-HT axon defects observed in our Lmx1bCKO mice is not accounted for by the substantial but not total loss of Tph2 expression and consequent substantial but partial reduction of 5-HT levels in these mice. In light of the Pasqualetti findings, we conclude that Tph2 and 5-HT levels need to be reduced to an extent greater than we achieved in either our Lmx1bCKO or our Tph2CKO mice to see defects in 5-HT arborization. Perhaps, 5-HT has to be totally eliminated as achieved the by the Pasqualetti group to see effects on 5-HT axons. We have now included an assessment of our Tph2 finding relative to those of the Pasqualetti lab in the revised Results.

Further, if possible, some quantification of the axon tract defects in the forebrain would add more strength to the description in this study.

We now include quantification of Td-tomato+ axon tracts and arbors in terminal target fields of Lmx1biCKO mice. See revised Figure 4 and Figure 5—figure supplement 1. In new Figure 4, we added a new panel, Figure 4F, presenting quantitation of P1 targeted axon tracts. In order to accommodate the new quantification, we placed the original panel Figure 5B, showing coronal cingulum bundles and SCS tracts, into a new supplemental figure (Figure 5—figure supplement 1A) along with the new quantification of TdTomato+ axons in tracts as well as cortex and hippocampus. We have replaced Figure 5D and Figure 9K with improved representative images.

3) Finally the reviewers raised a few points from the text that deserve revision or discussion:

– The statement that Lmx1 mutants have "axon primary outgrowth and selective routing defects " does not seem accurate. From the data provided, the outgrowth and routing of the serotonin raphe axons seem to be undisturbed during early embryonic stages and there are no clear abnormal trajectories later (at least in the data provided). This suggests that axon guidance and general axon targeting is overall normal, but that there is a stalling of growth along existing axon tracts- which starts to be visible at E16, there is also defective axon terminal branching with reduction in fiber density and aggregated axon terminals in some regions.

We maintain there is in fact a defect in primary stage 5-HT axon outgrowth as 5-HT axons exhibit delayed growth between E16.5 to E18.5. Further, we believe there is a profound defect at the subsequent selective 5-HT axon routing stage because multiple 5-HT routes including cingulum, SCS, and fornix are nearly completely lacking 5-HT axons. What is not entirely clear is whether the failure to selectively route is because of an inherent axonal growth defect or a defect in sensing guidance cues or perhaps even a failure in both processes. We agree our material gives the appearance of a failure of intrinsic growth potential because 5-HT axons initiate growth normally but then fail to extend at selective routing choice points. Moreover, we have never seen evidence in support of aberrant axon trajectories; all 5-HT axons seem to follow proper axon tracts up to a point. We wonder whether Lmx1b may be controlling a yet-to-be-defined intrinsic program that powers long distance 5-HT axonal growth capacity. However, we do not believe we can rule out axon guidance defects in the failure to selectively extend 5-HT axons through proper routes. 5-HT axons normally turn dorsally through the septal area at E18.5. However, the vast majority of mutant 5-HT axons fail to make the dorsal turn. We leave open the possibility that the failure to turn is a guidance defect at this particular area of the brain, which might constitute a critical choice point in building expansive axon 5-HT architectures. In support of a possible guidance defect, our RNA-seq studies indicated that Lmx1b controls expression of a large number of genes encoding guidance receptors and adhesion molecules. We discuss these points in the revised Discussion.

– To help integrate the new observations from this study into the larger literature on serotonin neuron development, the authors could provide a better perspective/discussion on how their phenotypes, resemble or differ from the ones described in other mutants. For example, i) The phenotype of the Lmx1B seems to be a sort of mix of the Gap43 KO and of the Pcadhc2 -KO, which makes sense given the fact that they are both down-regulated. ii) The phenotype of developing serotonin axons in the forebrain Pet1 cKO (Figure 8) is very similar to that described by Kiyasova et al. in the full Pet1-KO.

i) We agree with the reviewers that the 5-HT axon forebrain phenotype in Gap43 null mice looks outwardly similar to that reported in our Lmx1bCKO and Pet1cKO mice. This raises the possibility that loss of Gap43 in our cko mice accounts for part of the axons defects we report. However, it is not yet known whether Gap43 plays an intrinsic role in 5-HT axon development. Moreover, Shen et al., 2002 reported that Gap43 null mice have a devastating and widespread disruption of brain development: these mice are missing the hippocampal commissure (HC) and the corpus callosum (CC). These severe structural abnormalities could in fact be the primary cause of the failure of 5-HT axons to innervate cortical and hippocampal regions of Gap43 null mice (Donovan et al., 2002) because a majority of growing 5-HT axons use the HC and CC to route to these terminal target regions. However, Gap43 is expressed in 5-HT neurons, which raises the possibility that it also plays an intrinsic role in 5-HT axon development. Our findings highlight the potential importance of an intrinsic Lmx1b→Pet1→Gap43→5-HT axon regulatory path given that Gap43 expression is reduced in both Lmx1bCKO and Pet1CKO mice. It will be interesting to investigate this putative path in 5-HT conditionally targeted Gap43 mice using the ePet-Cre driver and yet to be generated mice carrying a Gap43 conditional allele. We discuss this in the revised Discussion.

ii) We have discussed this comment at length. Pet1 null mice lack 5-HT immunopositive axon fibers in many forebrain terminal target fields, which seemingly parallels the lack of Td-Tomato+ axons in these regions of Lmx1bCKO and Pet1CKO mice. However, it is difficult to directly compare the two mouse models. Kiyasova et al. focused on the minor residual population of 5-HT immunopositive axons present in the forebrain of Pet1 null mice. In our present study, we used the Ai9 reporter locus to mark and assess both 5-HT immunopositive axons as well as axons that have lost their 5-HT marker content because of Pet1 conditional targeting. Using the Pet1cKO mouse we discovered that Pet1 mutant Td-tomato+ axons, regardless of whether or not they are still 5-HT immunopositive, are unable to extend to the cortex or hippocampus.

– The normal morphology of the serotonin terminals in the PVT and intralaminar thalamic nuclei (Figure 8—figure supplement 1B) in the Pet1 cKO could support the notion that these are not misguided 5-HT axons, but serotonin axons with less dependence on Pet for growth, in a way similar to what they suggest for the spinal cord projections.

Yes, we agree with the reviewer’s interpretation. We find it interesting that the PVT is innervated by 5-HT mutant axons in Pet1cKO animals. We do believe that these axons properly reached the PVT in absence of Pet1, similar to spinal projections. This suggests Lmx1b might be acting independently of Pet1 in this specific highly discrete target field. In contrast, we believe Pet1cKO 5-HT axons do not properly innervate some other intralaminar thalamic nuclei (ITN) because we found an increased density of mutant axons in discrete areas of the ITN compared to controls (Figure 8—figure supplement 1B, asterisks). We have revised the Results subsection “An ascending-specific axonal Lmx1b→Pet1 regulatory cascade” to clarify this point.

– The transcriptional analysis reveals more widespread transcriptional changes in the caudal group than in the rostral raphe group, whereas the axonal alterations seem to predominate in the rostral group. Do the authors have a suggestion as to why this may be the case?

It is not clear why there are more widespread transcriptional changes in the caudal 5-HT neuron group than the rostral 5-HT group. It is not due to differences in Cre activity since we obtained equivalent Cre recombination efficiencies in both rostral (Figure 1—figure supplement 1) and caudal groups (Figure 2—figure supplement 1). We suggest one possibility is that there is greater cell sub-type diversity in the rostral group, which also has nearly twice the number of cells. Therefore, with more diversity, differences in RNA levels could be averaged out in the rostral group versus a more homogeneous caudal group.

https://doi.org/10.7554/eLife.48788.028

Article and author information

Author details

  1. Lauren J Donovan

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Conceptualization, Validation, Investigation, Interpretation of data
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5622-7402
  2. William C Spencer

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Writing—original draft, Writing—review and editing, Interpretation of data
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9700-8011
  3. Meagan M Kitt

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Investigation, Performed stereotaxic injection of rAAV2/Ef1a-DIO-hchR2-EYFP and in situ hybridization
    Competing interests
    No competing interests declared
  4. Brent A Eastman

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Investigation, Performed histochemical analysis and imaging of DKO mice
    Competing interests
    No competing interests declared
  5. Katherine J Lobur

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  6. Kexin Jiao

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Investigation, Methodology, Performed cell body morphological analyses and measurements, Performed Imaris tracing and imaging
    Competing interests
    No competing interests declared
  7. Jerry Silver

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Writing—review and editing, Interpretation of data
    Competing interests
    No competing interests declared
  8. Evan S Deneris

    Department of Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Writing—original draft, Writing—review and editing, Interpretation of data
    For correspondence
    esd@case.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4211-9934

Funding

National Institute of Mental Health (P50 MH096972)

  • Evan S Deneris

National Institute of Mental Health (RO1 MH062723)

  • Evan S Deneris

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Lynn Landmesser for key insights and suggestions throughout the course of this study. We thank Polyxeni Philippidou for her many helpful comments on the manuscript. We thank Wen-Cheng Xiong for the use of the BZ-X700 fluorescence microscope. We thank Randy Johnson for Lmx1b floxed mice. We thank Ralph Witzgall for the Lmx1b antibody. We thank Steven Wyler for the pup picture. This research was supported by the Genomics Core Facility and the Flow cytometry core at the CWRU School of Medicine. This research was supported by NIH grants P50 MH096972 and RO1 MH062723 to ESD.

Ethics

Animal experimentation: All animal procedures used in this study were in strict accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Case Western Reserve University School of Medicine Institutional Animal Care and Use Committee (Animal Welfare Assurance Number A3145-01, protocol #: 2014-0044).

Senior Editor

  1. Eve Marder, Brandeis University, United States

Reviewing Editor

  1. Anne E West, Duke University School of Medicine, United States

Reviewer

  1. Patricia Gaspar, INSERM, U839, Institut du Fer à Moulin, France

Publication history

  1. Received: May 24, 2019
  2. Accepted: July 27, 2019
  3. Accepted Manuscript published: July 29, 2019 (version 1)
  4. Version of Record published: August 7, 2019 (version 2)

Copyright

© 2019, Donovan et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 2,938
    Page views
  • 339
    Downloads
  • 20
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Lauren J Donovan
  2. William C Spencer
  3. Meagan M Kitt
  4. Brent A Eastman
  5. Katherine J Lobur
  6. Kexin Jiao
  7. Jerry Silver
  8. Evan S Deneris
(2019)
Lmx1b is required at multiple stages to build expansive serotonergic axon architectures
eLife 8:e48788.
https://doi.org/10.7554/eLife.48788

Further reading

    1. Developmental Biology
    2. Stem Cells and Regenerative Medicine
    Brian Silver, Kevin Gerrish, Erik Tokar
    Research Article

    Cell-free DNA (cfDNA) present in the bloodstream or other bodily fluids holds potential as a non-invasive diagnostic for early disease detection. However, it remains unclear what cfDNA markers might be produced in response to specific tissue-level events. Organoid systems present a tractable and efficient method for screening cfDNA markers. However, research investigating the release of cfDNA from organoids is limited. Here, we present a scalable method for high-throughput screening of cfDNA from cardiac organoids. We demonstrate that cfDNA is recoverable from cardiac organoids, and that cfDNA release is highest early in differentiation. Intriguingly, we observed that the fraction of cell-free mitochondrial DNA appeared to decrease as the organoids developed, suggesting a possible signature of cardiac organoid maturation, or other cardiac growth-related tissue-level events. We also observe alterations in the prevalence of specific genomic regions in cardiac organoid-derived cfDNA at different timepoints during growth. In addition, we identify cfDNA markers that were increased upon addition of cardiotoxic drugs, prior to the onset of tissue demise. Together, these results indicate that cardiac organoids may be a useful system towards the identification of candidate predictive cfDNA markers of cardiac tissue development and demise.

    1. Developmental Biology
    2. Neuroscience
    Sweta Parab, Olivia A Card ... Ryota L Matsuoka
    Research Article Updated

    Fenestrated and blood-brain barrier (BBB)-forming endothelial cells constitute major brain capillaries, and this vascular heterogeneity is crucial for region-specific neural function and brain homeostasis. How these capillary types emerge in a brain region-specific manner and subsequently establish intra-brain vascular heterogeneity remains unclear. Here, we performed a comparative analysis of vascularization across the zebrafish choroid plexuses (CPs), circumventricular organs (CVOs), and retinal choroid, and show common angiogenic mechanisms critical for fenestrated brain capillary formation. We found that zebrafish deficient for Gpr124, Reck, or Wnt7aa exhibit severely impaired BBB angiogenesis without any apparent defect in fenestrated capillary formation in the CPs, CVOs, and retinal choroid. Conversely, genetic loss of various Vegf combinations caused significant disruptions in Wnt7/Gpr124/Reck signaling-independent vascularization of these organs. The phenotypic variation and specificity revealed heterogeneous endothelial requirements for Vegfs-dependent angiogenesis during CP and CVO vascularization, identifying unexpected interplay of Vegfc/d and Vegfa in this process. Mechanistically, expression analysis and paracrine activity-deficient vegfc mutant characterization suggest that endothelial cells and non-neuronal specialized cell types present in the CPs and CVOs are major sources of Vegfs responsible for regionally restricted angiogenic interplay. Thus, brain region-specific presentations and interplay of Vegfc/d and Vegfa control emergence of fenestrated capillaries, providing insight into the mechanisms driving intra-brain vascular heterogeneity and fenestrated vessel formation in other organs.